ID: 1136662808

View in Genome Browser
Species Human (GRCh38)
Location 16:31780059-31780081
Sequence CAAAATGCTGGTAGTGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 3, 1: 39, 2: 79, 3: 94, 4: 219}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136662803_1136662808 4 Left 1136662803 16:31780032-31780054 CCTAGAGACTTATTGAATGGCTT 0: 61
1: 1594
2: 1936
3: 1357
4: 856
Right 1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG 0: 3
1: 39
2: 79
3: 94
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136662808 Original CRISPR CAAAATGCTGGTAGTGATAT GGG Intronic