ID: 1136662808

View in Genome Browser
Species Human (GRCh38)
Location 16:31780059-31780081
Sequence CAAAATGCTGGTAGTGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 3, 1: 39, 2: 79, 3: 94, 4: 219}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136662803_1136662808 4 Left 1136662803 16:31780032-31780054 CCTAGAGACTTATTGAATGGCTT 0: 61
1: 1594
2: 1936
3: 1357
4: 856
Right 1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG 0: 3
1: 39
2: 79
3: 94
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136662808 Original CRISPR CAAAATGCTGGTAGTGATAT GGG Intronic
905526269 1:38642213-38642235 CTAAATCCTGGTTTTGATATGGG - Intergenic
906760568 1:48373410-48373432 AAAAATTCTGATAGCGATATGGG - Intronic
907158476 1:52355029-52355051 CAAAATGCAGGTGGAGAGATTGG - Intronic
907519909 1:55016385-55016407 CAAAATGATGCCAGTGTTATGGG - Intergenic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909097461 1:71305570-71305592 CAAAATGCTGGGATGGATATTGG + Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909236019 1:73153345-73153367 GAAAATGCTGATAGTGATAATGG - Intergenic
909542475 1:76806429-76806451 CAGAATGTTGGTAGAGATATAGG + Intergenic
909752459 1:79179593-79179615 CAAAAGCCTGATAGTGATATGGG - Intergenic
911064776 1:93778480-93778502 CAGATTGCTGGTAATAATATTGG - Intronic
911407731 1:97463659-97463681 AAAAATGCTGATAATGATAAGGG + Intronic
912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG + Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
915787576 1:158632656-158632678 CAGAATGCTAGCAGGGATATAGG + Intronic
916517212 1:165530477-165530499 CAAAATGTTAATAGTGATAATGG + Intergenic
917728704 1:177852902-177852924 GAGAATGCTGGCAGTGTTATTGG - Intergenic
917771951 1:178289112-178289134 CACAATTCTGGCAGTGATGTGGG - Intronic
918484541 1:185015465-185015487 CAAAATGCTAGTACTAATAAGGG - Intergenic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
920927780 1:210358837-210358859 CAAAATGCTGAGAGTGAAAAGGG + Intronic
921042418 1:211446730-211446752 GAAAATACTGGTAGTGATACTGG - Intergenic
921274084 1:213500292-213500314 CAAAATGAAGATGGTGATATTGG - Intergenic
921387373 1:214584236-214584258 CAAAGTGCTGCTAGTGATACTGG + Intergenic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
922638705 1:227204636-227204658 TGAAATGCTGTTAGAGATATTGG - Intronic
923440107 1:234009782-234009804 CAATCTGCTGATAGTCATATTGG - Intronic
1065142795 10:22735687-22735709 CAAACTGGTGGTCGTGATATAGG + Intergenic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1066508563 10:36070068-36070090 GAAAATTGTGGAAGTGATATTGG + Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1068108873 10:52654658-52654680 CAAATTGCTTGTAATGTTATTGG + Intergenic
1068233839 10:54206400-54206422 TAAAATTCTGATAGTGATAAAGG + Intronic
1068710246 10:60126056-60126078 GAAAATTCTGTAAGTGATATTGG - Intronic
1070465493 10:76718854-76718876 CAAAATGCTGGCAGGAATAGGGG - Intergenic
1070951453 10:80434664-80434686 CAAAAAGCTGGTAAGGAGATTGG + Exonic
1071512079 10:86268336-86268358 CCAAATGCTGTTGGTGATACCGG - Intronic
1072296103 10:94010847-94010869 CAAAATACTGATAGAAATATGGG - Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073203541 10:101755547-101755569 CAAAAAACTGGTATTGATCTTGG + Intergenic
1073398833 10:103240470-103240492 CAAAATGCAGGAAGTGAGAAAGG + Intergenic
1073670518 10:105582553-105582575 CAAGATTCTGATAATGATATTGG + Intergenic
1074075865 10:110123959-110123981 CCAAATGCTGTTATTGATACAGG + Intronic
1077736923 11:4801083-4801105 CAAAATGCTGATAGAAATATGGG - Intronic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1079559520 11:21804561-21804583 CAAAATCCTAACAGTGATATGGG - Intergenic
1079707443 11:23638295-23638317 CAAATTGCTGATAGTGATATGGG - Intergenic
1079838742 11:25367547-25367569 CAAAATGGTGATAATTATATGGG - Intergenic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1080292490 11:30686692-30686714 CAAAATGCTGGTTGTAACAACGG - Intergenic
1080997171 11:37618383-37618405 CAAAATACTGATAGTAACATGGG + Intergenic
1081122757 11:39286521-39286543 CAAAATACTGATAGCGATATGGG - Intergenic
1081361628 11:42187279-42187301 GAAAATGATGGTAGTGTGATTGG - Intergenic
1082708086 11:56518321-56518343 CAAAGTGCTGGTAGAAATAGGGG - Intergenic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1083168081 11:60903869-60903891 GAAAAGGCTGGTAGTGAGCTTGG + Intronic
1083982449 11:66184021-66184043 CAAAATGATGGTCGTGAGGTAGG - Intronic
1084494843 11:69497809-69497831 GAAAATGCTGGTATAGGTATAGG + Intergenic
1084913023 11:72406579-72406601 CAAAATGATGGAAGTGAGATAGG - Intronic
1086827358 11:91516001-91516023 CAAAATGGGGGTCGTAATATCGG + Intergenic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087251866 11:95910207-95910229 AAAAATACTGGTGGTGAAATTGG - Intronic
1087511045 11:99094090-99094112 CTTAATGGTGGTAGTGATAAGGG - Intronic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088350780 11:108885203-108885225 GAAAAAACTGGTAGTGACATGGG - Intronic
1090506603 11:127321514-127321536 TAAAATGCTGATAGTGTTATGGG - Intergenic
1090685477 11:129113107-129113129 CAAAATGCTACTAGTGATGCTGG - Intronic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1092704647 12:11269068-11269090 CAATGTGCTGGGAGTGGTATAGG - Intronic
1092712764 12:11354952-11354974 CAATGTGCTGGGAGTGGTATGGG - Intronic
1092716562 12:11394928-11394950 CAATGTGCTGGGAGTGGTATGGG - Intronic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1094738176 12:33259101-33259123 CAAAATGCTGTTAGTGAATGTGG + Intergenic
1095252398 12:39994501-39994523 TATTATGGTGGTAGTGATATGGG - Intronic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095864933 12:46961413-46961435 AAAAATGATGGCAGTTATATGGG + Intergenic
1096928381 12:55174409-55174431 CAAAATACTGGTGAGGATATAGG - Intergenic
1096960340 12:55570708-55570730 CAAAATACTGATAGCAATATGGG - Intergenic
1097343751 12:58468239-58468261 AAAAATGGTGATAGTGATATGGG - Intergenic
1098266710 12:68728986-68729008 CAAAGTGCCAGTAGTGATACTGG - Intronic
1098741663 12:74179832-74179854 CAAAATGCTTACAGTGATACGGG - Intergenic
1099124305 12:78733154-78733176 CAAAAAGCTGTTTGTAATATTGG + Intergenic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099607848 12:84828251-84828273 CAAAATGCTAATACTGATATGGG + Intergenic
1099655168 12:85479921-85479943 CAAAATGCTGGTAGTGATATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1099746113 12:86707193-86707215 CAAAATTGTGGTAGTGACTTTGG + Intronic
1100192486 12:92207837-92207859 CAAAATGCTGGGATTTTTATAGG + Intergenic
1100579109 12:95921889-95921911 CAAAATGATTCTAGTGATTTGGG - Intronic
1100778885 12:98002776-98002798 TAAAATGCTGTTACTGACATTGG - Intergenic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1102411465 12:112723563-112723585 CAAAATGCCATTAGTGATGTTGG - Intronic
1103113379 12:118302860-118302882 CAAAATGGTAGTCGTGATATTGG - Intronic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1105715568 13:23059467-23059489 CAAAATGATGGAATTGACATTGG - Intergenic
1105734519 13:23254236-23254258 CAAAATGCTGTTAGAAATGTGGG + Intronic
1105878155 13:24578336-24578358 CAAAATGCTGGGAGTTCTTTAGG + Intergenic
1105922046 13:24972282-24972304 CAAAATGCTGGGAGTTCTTTAGG - Intergenic
1107234338 13:38150902-38150924 CCAAATGCTGGTAAAGATGTGGG + Intergenic
1109083857 13:57944275-57944297 AAAAGTCCTGGTTGTGATATTGG + Intergenic
1109359703 13:61280214-61280236 CAAAATGCTAATAGTGATATTGG + Intergenic
1110007662 13:70293249-70293271 CAAAATGTTGATGGTGATATGGG + Intergenic
1110803567 13:79728703-79728725 AAAAATGTTGGTAGTGTGATAGG + Intergenic
1111077159 13:83251796-83251818 CAAAATGATTGTAATAATATAGG - Intergenic
1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG + Intergenic
1111703986 13:91725117-91725139 CAGAATGGTGGAAGTGATATGGG + Intronic
1111766913 13:92543011-92543033 CCAAATGTTGGGAGAGATATGGG - Intronic
1112095666 13:96129232-96129254 GAAAATGTTGGTGGTGATATAGG + Intronic
1112859015 13:103807793-103807815 CAAAATGCTGGTAGTTACATGGG + Intergenic
1112861455 13:103833063-103833085 CAAAATACTGATACTGATATTGG + Intergenic
1114084060 14:19225638-19225660 CAAAATGCTGGTTTTGTTCTAGG - Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114507520 14:23229328-23229350 AATAATGCTGGTAGGAATATTGG + Intronic
1114917271 14:27284740-27284762 CAAAATGCTGATAAAGATTTTGG + Intergenic
1114961278 14:27893089-27893111 CAAAATGTTGATAATCATATGGG + Intergenic
1115533355 14:34346783-34346805 CAAAATGATGGTAATGAGAGTGG - Intronic
1116147848 14:41098975-41098997 CAAAATGCTGATAGCAATATGGG + Intergenic
1116196141 14:41728067-41728089 GAAAATTCTGGTAATGATTTTGG + Intronic
1116759804 14:48998159-48998181 CACAAATCTAGTAGTGATATTGG - Intergenic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1120072723 14:80122036-80122058 CAAAATGCTGATAGAAATATGGG + Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1202895670 14_GL000194v1_random:7489-7511 CAAAATGCTGGTTTTGTTCTAGG - Intergenic
1123827176 15:24093734-24093756 CACAATGCTGATAGTGACATGGG - Intergenic
1123841782 15:24254613-24254635 CACAATGCTGATAGTGACATGGG - Intergenic
1123861159 15:24468067-24468089 CACAATGCTGATAGTGACATGGG - Intergenic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1130186589 15:81689318-81689340 CAAAATGCTTCAAGAGATATGGG - Intergenic
1130350686 15:83089055-83089077 CAAAATCCTGGTAGTGAAGCGGG + Intergenic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1131410101 15:92200401-92200423 CAAAATGCTGATAGAAATATGGG + Intergenic
1131453657 15:92566408-92566430 CAAAATGCTCATAGAAATATGGG - Intergenic
1134193600 16:12141344-12141366 GTAAATGCTGGTAGTGCTAATGG + Intronic
1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG + Intronic
1139041240 16:63001518-63001540 CAAAATGCTGATAGTAATGTGGG + Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1141959890 16:87398359-87398381 TAAAAAGCTGGAAGTGATAAGGG + Intronic
1142909981 17:3080656-3080678 CAAAATGTTGAAAGTGATAATGG - Intergenic
1144319573 17:14101066-14101088 CTAAATGCTGGCAGTGTGATGGG + Intronic
1146530045 17:33600810-33600832 CAGAATGTTGGTAGAAATATGGG + Intronic
1147898782 17:43769965-43769987 CAAAGTGCTGGTGAAGATATGGG + Intronic
1149025004 17:52017343-52017365 CAAAATGCTGATAGAAACATTGG + Intronic
1149364563 17:55929660-55929682 TATAATGCTGGTAGTTAGATAGG - Intergenic
1153883496 18:9441212-9441234 CAAACTGCTGTTGGTGCTATTGG - Intergenic
1154077365 18:11216915-11216937 CAATAACCTGGTAGTAATATGGG + Intergenic
1154236736 18:12612931-12612953 CATAATGGTGGTAGTGATGGTGG - Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1165916275 19:39262910-39262932 CAATATGCTGGTTGTGGTATTGG + Intergenic
1166017420 19:39993266-39993288 TAAAATGCTGATAGTGATAACGG + Intronic
1168565315 19:57417476-57417498 TAAAATGCTGGTTGTTATTTTGG + Intronic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
925638535 2:5965658-5965680 CAAAATGCCGATAGTGATATGGG - Intergenic
926375249 2:12220784-12220806 TAAAGTGTTGGTAGTGATGTGGG - Intergenic
927010715 2:18900842-18900864 CAGACTGCTGGTGGTGATGTTGG + Intergenic
929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG + Intergenic
929221741 2:39471777-39471799 GAAAATGTTGGCATTGATATGGG + Intergenic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
929702328 2:44174389-44174411 CCAATTACTGGTAGTGATATAGG + Intronic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
930952243 2:57156868-57156890 AAAAATGCTGATAGAGATATGGG - Intergenic
932783689 2:74580792-74580814 CAGAATACTGGTAGTGGTAGTGG - Intronic
933036462 2:77405524-77405546 AAAAATGCAGGAAGTGACATTGG - Intronic
933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG + Intronic
935322762 2:101905226-101905248 CATGATGTTGGTAGTGTTATTGG + Intergenic
935330051 2:101970342-101970364 CAAAATGCAGATAGAAATATGGG - Intergenic
935331532 2:101981006-101981028 CAAACTGCACGAAGTGATATCGG - Intergenic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
938492531 2:131770443-131770465 CAAAATGCTGGTTTTGTTCTAGG + Intergenic
938495037 2:131791904-131791926 CAAAATGCTGGTTTTGTTCTAGG - Intergenic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940594309 2:155770127-155770149 CAAAATGATGGTGATGATGTTGG - Intergenic
940621644 2:156120989-156121011 CAAAATGCTAATAGTGATATGGG + Intergenic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
942011192 2:171763920-171763942 CAAAATGCCAGTAGTGATTCTGG + Intergenic
943223583 2:185140695-185140717 CAAAAAGCCGATAGTGATGTGGG - Intergenic
943322458 2:186462386-186462408 CAAAATGCTGGTGGTAGTACAGG + Intergenic
944705296 2:202282950-202282972 CAAAATGCTGGGATTATTATAGG - Intronic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
946135811 2:217646040-217646062 CAAAATGCAGGAAGTGATTCAGG - Intronic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
948158348 2:235802621-235802643 CAAAATGATGGTGGTGATGATGG + Intronic
948619743 2:239227023-239227045 CAAAATGCTGGAAGTCAGAAAGG + Intronic
1169792266 20:9423886-9423908 AAAATTGTTGGTAGTGATAATGG - Exonic
1170046231 20:12088363-12088385 CAAAATGTTGGTTGTGAGAAAGG - Intergenic
1170725164 20:18919682-18919704 CACAATGCTGATAGTGATATGGG + Intergenic
1170903972 20:20494743-20494765 CAAAATGCTAGATGTGATATGGG + Intronic
1173246026 20:41338187-41338209 CAAACAGCTGCCAGTGATATAGG + Intergenic
1173323519 20:42010746-42010768 CAAAATGCTGACAGTGATAATGG - Intergenic
1176518578 21:7806823-7806845 CTAAATGGTGGTGGTGATAATGG - Intergenic
1176615365 21:9023551-9023573 CAAAATGCTGGTTTTGTTCTAGG - Intergenic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177604557 21:23360804-23360826 CAAAACGCTGATAGTGATACGGG - Intergenic
1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177992730 21:28058182-28058204 CTAAATGCTGACAATGATATGGG + Intergenic
1178143882 21:29716492-29716514 CAAAATGCTGATAGTAATGTGGG + Intronic
1178149665 21:29779842-29779864 CAAAATGTAGATAGTGAGATTGG + Intronic
1178652606 21:34436836-34436858 CTAAATGGTGGTGGTGATAATGG - Intergenic
1179156464 21:38855975-38855997 CAAAATGCTGATAATAATAGGGG + Intergenic
1179190185 21:39116741-39116763 TAATATGCTGGTAGACATATGGG + Intergenic
1179306333 21:40156710-40156732 CACAATGGTGGTAGTGATATAGG + Intronic
1179495293 21:41767411-41767433 CAATATCCTGGTTGTGAGATTGG - Intergenic
1180293913 22:10867565-10867587 CAAAATGCTGGTTTTGTTCTAGG + Intergenic
1180496719 22:15896980-15897002 CAAAATGCTGGTTTTGTTCTAGG + Intergenic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
1182069925 22:27456316-27456338 CACCAAGCTGGTAGTGATTTTGG + Intergenic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
957903964 3:86534174-86534196 CAAAATACTGGTAGAAATATGGG - Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958813877 3:98894443-98894465 CAAATTGCTGGCACTGATTTAGG + Intronic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959959719 3:112284079-112284101 GATAATGCTGGAAGTGAAATTGG + Intronic
962139564 3:132774272-132774294 CAATATCTTGATAGTGATATGGG - Intergenic
962579206 3:136782491-136782513 CCAACTGCTGGGAGTGGTATTGG - Intergenic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963433805 3:145242550-145242572 CAACATGCTGATAGTGATAAGGG - Intergenic
963539566 3:146567790-146567812 CAAAATGATGATAGTGATATGGG - Intergenic
964076786 3:152701462-152701484 CAGAATGCTCATAGTGATAGTGG - Intergenic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
965232713 3:166073438-166073460 AAAAATGCTGATAGAAATATGGG - Intergenic
965326460 3:167310228-167310250 CAAAATGCTTATAGTGATAATGG - Intronic
965349305 3:167594280-167594302 CAAAATGTTCATAGTGATATGGG + Intronic
966075783 3:175935602-175935624 CAAAATGCAGGTAGTGATATGGG + Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
966921008 3:184611328-184611350 GAAGATGCCGGTAGTGATACTGG - Intronic
967064602 3:185903664-185903686 CAAAGTGCTGGTATTGTTACAGG - Intergenic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
970812766 4:20114578-20114600 TTAAATGCTGGAAGTGAAATTGG + Intergenic
971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG + Intergenic
971546637 4:27894725-27894747 CAGAATGTTGGTAGATATATGGG - Intergenic
971601823 4:28601789-28601811 AAAAATGTTGGTAGATATATAGG + Intergenic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
973072045 4:45873891-45873913 GACAATGCTGGTACTGAAATGGG - Intergenic
973131451 4:46653509-46653531 CACAATGGTGGTACTGGTATTGG + Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
974637921 4:64589675-64589697 CAGAATGCTGATAGTGATATGGG + Intergenic
974724105 4:65777061-65777083 CAAAATTCTGATAATGATACGGG + Intergenic
974887223 4:67834426-67834448 CAAAGTGATGGTAGTCCTATGGG - Intronic
975489358 4:74971520-74971542 CAAAATGCTGTTAATAAAATAGG - Intronic
975507262 4:75151299-75151321 AAAAATGCTGGTGAGGATATAGG - Intergenic
975819658 4:78257024-78257046 CAAAATGGTGGTAGTGATGGTGG - Intronic
976235549 4:82892489-82892511 GATAATGCTGGAAGTGAAATTGG - Intronic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
977936039 4:102805653-102805675 AAAAATGCTGGTATTCTTATAGG + Intronic
979060987 4:116059935-116059957 CAAAGTGCTGATAGTGATGTGGG - Intergenic
979125708 4:116969397-116969419 CAAAATGCTAATAGTGCTATTGG - Intergenic
979423857 4:120540163-120540185 CAAAATGCTTATAGTCATGTTGG - Intergenic
979857168 4:125648910-125648932 CCAAATGTTGGCAGTGATTTTGG - Intergenic
979909303 4:126341298-126341320 CAAAAATCAGGTAGTCATATTGG + Intergenic
979942173 4:126775335-126775357 CAAAACACTGAAAGTGATATTGG - Intergenic
980731818 4:136833585-136833607 CAAAAGCCTGGTAGTGATATGGG + Intergenic
981048031 4:140283442-140283464 AAAAATGCTTGTAGTGTTATAGG - Intronic
981343249 4:143647051-143647073 TAAAATGTTGATAGTGATATGGG + Intronic
981355372 4:143783941-143783963 CAAAATGCTGGTAGAAATATGGG + Intergenic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981412066 4:144443373-144443395 CAAAATGCTGTTAGTAATACGGG - Intergenic
981503193 4:145474189-145474211 CAAAATGCTAATAGTGATATGGG - Intergenic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
982210281 4:153029194-153029216 CAAAATGCTGATAGAAATATGGG - Intergenic
983320427 4:166190070-166190092 GAAAATGCTGATAATGATATGGG + Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983660360 4:170125563-170125585 TAAAATGCTGATAATGATATTGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
984131358 4:175879139-175879161 CAAAATGCTAATAATGATATGGG - Intronic
984512358 4:180694017-180694039 CAAAATACTAATAGTGATATAGG - Intergenic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
986911693 5:12565592-12565614 CAAAATGTCGATAATGATATTGG - Intergenic
987459955 5:18197400-18197422 CAAAATGCTGAAAGAAATATGGG + Intergenic
987533209 5:19148797-19148819 CAAAATGCTGATAGTGACGAGGG - Intergenic
987918647 5:24249435-24249457 CAAAATGCTGACAGTGACATGGG - Intergenic
988009510 5:25464379-25464401 CATAATGCTGATAGTAATATGGG + Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988076760 5:26363821-26363843 CAATATGCTGATAGTGATAAGGG + Intergenic
988456307 5:31390007-31390029 CAAAATGCTAATAGTGATATGGG - Intergenic
988876866 5:35456644-35456666 CAAAATGCTGATGGTGATAGGGG + Intergenic
988995522 5:36711358-36711380 GAAAATGCTGCTATTGAAATGGG - Intergenic
989501963 5:42178059-42178081 TGAAATGCTAATAGTGATATGGG - Intergenic
989677025 5:43984164-43984186 CAAAATGCTGACAGTGACATGGG - Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990075844 5:51844583-51844605 CAAAATGCCAATAGGGATATAGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
991453915 5:66782025-66782047 CAAAGTGCTGGGAGTGTTACAGG - Intronic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993226430 5:85170912-85170934 GAAAATGTTGGTAGTCATAAAGG + Intergenic
993792625 5:92225203-92225225 CAAAATACTGATAGTGAGATGGG - Intergenic
993885372 5:93409607-93409629 CAAACTCCTGGTCGTGATACTGG - Intergenic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994849569 5:105036671-105036693 CAAAACCCTGATAGTGATATGGG - Intergenic
995211964 5:109550959-109550981 CAAAATGCTGATAGCCATATGGG + Intergenic
995779893 5:115763660-115763682 CAAAATGGTTTTAGTGATATGGG - Intergenic
996185493 5:120468680-120468702 TTAAATGCTGGTATTAATATGGG + Intronic
996502345 5:124230761-124230783 CCAAATGCTGGTAGTGAAGTAGG - Intergenic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000768416 5:165319765-165319787 CAAAAAGCTGATAGTGATATGGG - Intergenic
1002060522 5:176623124-176623146 CAAAATGCTGGGAGTGGTAACGG - Intronic
1003654297 6:7991416-7991438 GACAATGCTGGAAGTGAAATGGG + Intronic
1003798236 6:9630197-9630219 CCAAATGCTGATAGTGACATGGG + Intronic
1004324043 6:14657468-14657490 CACAATGCTGATAGGGCTATTGG - Intergenic
1004809427 6:19243347-19243369 CAAAATGGTGCTAGTGAAACTGG + Intergenic
1006344060 6:33465786-33465808 CAAAATGCTGATAGCAATATGGG + Intergenic
1006789689 6:36691771-36691793 CCAAATGCTGGTAGTGAGTAAGG - Intergenic
1008284012 6:49627405-49627427 CAAAATGGTGATAGTGAGATGGG - Intronic
1008952966 6:57181080-57181102 CAGAATGTTGGTAGGGATATGGG + Intronic
1009620429 6:66068271-66068293 CTAAATGCTAGCAGTGATTTTGG - Intergenic
1009635004 6:66253751-66253773 CCAAATGCTGATAATGATATGGG - Intergenic
1009710119 6:67307579-67307601 CACAACGCTGATAGTGATAATGG + Intergenic
1009732082 6:67621728-67621750 AAAAATACTGATAATGATATGGG + Intergenic
1009879909 6:69553960-69553982 AAAAATGATGGAGGTGATATTGG - Intergenic
1010420548 6:75669787-75669809 TAAAATGCTGCTAGTTATAGTGG - Intronic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1011796383 6:90958135-90958157 CTAAATGCTAGTAGAAATATGGG - Intergenic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1012569001 6:100699691-100699713 CAAAATGCTGATAATGATTTGGG + Intronic
1012765499 6:103362467-103362489 CAAAATGCTCATAGTGATATGGG + Intergenic
1013112925 6:107078806-107078828 TAGCATGCTGGTAGTGATATGGG + Intronic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1013914022 6:115312565-115312587 CAAAGTACTGGGAGAGATATGGG - Intergenic
1014483472 6:121968765-121968787 CATAATGCTGTTAGTGGCATAGG + Intergenic
1014791358 6:125676042-125676064 CAAAAAACTGGTAGTAAAATGGG - Intergenic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1016152136 6:140754457-140754479 GAAAAGCCTGGAAGTGATATTGG + Intergenic
1018381452 6:163261490-163261512 CAAATTGCTGCTGGTGATAATGG - Intronic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1020725555 7:11809208-11809230 CAAATTACTGGTAATGATTTTGG - Intronic
1020843130 7:13246538-13246560 TAAAATGCTACTAGTGATACTGG - Intergenic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1024312995 7:47986970-47986992 CTAAATGATAGTAGTGATAGTGG + Intergenic
1024383614 7:48726149-48726171 CAATATGCTGATAATGATATGGG - Intergenic
1024832228 7:53474049-53474071 CTAAGTGGTGGCAGTGATATTGG + Intergenic
1024982168 7:55166725-55166747 CACAATGGTGGTAGTGATGATGG + Intronic
1024982194 7:55166860-55166882 CACAATGGTGGTAGTGATGATGG + Intronic
1025062881 7:55826312-55826334 CAAAATTCTCTTTGTGATATAGG - Intronic
1025961661 7:66227653-66227675 CAAGATGCTGGCAGTGGTAGTGG + Intronic
1026456443 7:70576435-70576457 CAAAATGCAAGTGCTGATATGGG - Intronic
1026532980 7:71215845-71215867 CAAAATGCTTGTATTGAGATAGG + Intronic
1029997673 7:105024058-105024080 CAAAATGTTGGTAGTGAATTTGG + Intronic
1031202517 7:118706260-118706282 TAAAATGCTGTCAGTGTTATTGG + Intergenic
1031241999 7:119257794-119257816 AAAAATGTTGGTATTGTTATGGG + Intergenic
1031261928 7:119532438-119532460 CAAAATTCTGATAGTGATGTGGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1032946596 7:136860677-136860699 CAAAATGCTTTTAATGTTATGGG + Intergenic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1036893878 8:12615122-12615144 CAAAATGCTGATGGTTATATGGG - Intergenic
1038377259 8:27053845-27053867 CAATATCCTGGTGGTGATATGGG + Intergenic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1039083862 8:33760392-33760414 CTGAATGCTGGTAGTTCTATAGG + Intergenic
1040540120 8:48346346-48346368 CAAAATGCTGATGGTGATAGGGG + Intergenic
1041854294 8:62432912-62432934 CAAATGGCTGGTAGGGACATAGG - Intronic
1043694665 8:83203887-83203909 CAAAATGCTGATGGTGATATGGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044105969 8:88207523-88207545 CAAAGTGCTGCTAGTGATGCTGG + Intronic
1044110096 8:88262570-88262592 CAATATAGTGGTAGTTATATAGG + Intronic
1044127104 8:88472209-88472231 CAAAATGCTGAGAGTGATATGGG - Intergenic
1044164626 8:88966871-88966893 CAGAATGTTGGTAGAAATATTGG + Intergenic
1044326821 8:90868437-90868459 CAAAATGTCCATAGTGATATGGG + Intronic
1045050589 8:98320677-98320699 CAAAATGCTGATAGCAATACGGG - Intergenic
1045518607 8:102883400-102883422 AATAATGCTGGTAGTAATGTAGG - Intronic
1045598532 8:103685861-103685883 AAAAATGCTGGGAGTTTTATTGG + Intronic
1045730431 8:105232663-105232685 CCAAATGCTGGCAATGATATGGG - Intronic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046151855 8:110237727-110237749 CTAAATGCTGGTAAGGATGTGGG - Intergenic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1048699932 8:137077441-137077463 CAAAATGTTGATAATGATATGGG + Intergenic
1048726231 8:137388068-137388090 CACAATGCTGATAGTGATATGGG - Intergenic
1048806452 8:138245905-138245927 CAAATTGCTGATAGTGATATGGG + Intronic
1050589641 9:7148610-7148632 CCAAATGGTGGGAGTGAAATGGG - Intergenic
1050660210 9:7876197-7876219 CAAAATGCTTATAGTAATATGGG + Intronic
1050890625 9:10819845-10819867 AAAAATGCTGAGAGTGATATGGG - Intergenic
1050897368 9:10900201-10900223 CAAAATGATGATAGTGATATGGG - Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1051844552 9:21436878-21436900 CAAAATGGTAGAAGGGATATAGG - Intronic
1052220715 9:26018288-26018310 TAAAATGCTGATAATGATATGGG - Intergenic
1052635430 9:31097742-31097764 CCAAATGCTGACAATGATATAGG + Intergenic
1053646792 9:40125794-40125816 CAAAATGCTGGTTTTGTTCTAGG + Intergenic
1053758925 9:41337774-41337796 CAAAATGCTGGTTTTGTTCTAGG - Intergenic
1054327806 9:63723679-63723701 CAAAATGCTGGTTTTGTTCTAGG + Intergenic
1054537779 9:66250159-66250181 CAAAATGCTGGTTTTGTTCTAGG - Intergenic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1055230386 9:74057205-74057227 TAAAATGCATGTAGTGATAATGG - Intergenic
1055840303 9:80495235-80495257 CAGAATGTTGGTAGAAATATGGG - Intergenic
1057011172 9:91602809-91602831 CCAAATGCTGGTGAGGATATGGG - Intronic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1057732245 9:97620473-97620495 CAAAAAGGTGGAAGTGATTTTGG + Intronic
1058050571 9:100402066-100402088 GAAAATGCTGGTAGGGATCAGGG - Intergenic
1058271459 9:102976696-102976718 CATAATGCTGGTAGAAATACAGG - Intergenic
1058722156 9:107773933-107773955 CAAAATGCTGACAGTTATATGGG - Intergenic
1059570175 9:115425833-115425855 CTAACTGCTGATAATGATATGGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1059917171 9:119116958-119116980 CAAAATGTTGATAGAAATATGGG + Intergenic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1203654845 Un_KI270752v1:13832-13854 CAAAATGATTGTAGGGATAGGGG - Intergenic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1188749163 X:33884559-33884581 CAAAATGCTGATGGTTATATGGG + Intergenic
1189071390 X:37867288-37867310 CAGAATGCTGATAGTGATATGGG - Intronic
1189135519 X:38545553-38545575 CCAAATTCTGGTGGTCATATGGG - Intronic
1189350004 X:40269082-40269104 CAAAATGCTTTTGGTTATATTGG - Intergenic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1189872161 X:45395227-45395249 AAATATGCTGATAGTCATATTGG + Intergenic
1190362584 X:49662977-49662999 GAACATCCAGGTAGTGATATAGG + Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191760806 X:64646452-64646474 CAAAATGTTGATAGTAATATGGG + Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1192934990 X:75849954-75849976 AAAAATGCTGATAATGATATGGG - Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194418948 X:93649034-93649056 CCAAATGGTGATGGTGATATGGG + Intergenic
1195765644 X:108294019-108294041 ATAAATGCTGGTAGTTATTTTGG - Intronic
1196028954 X:111074781-111074803 CAAAATGCTGATGGAGATGTGGG + Intronic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1197392302 X:125882939-125882961 CAAAATGCAGACAGTAATATGGG + Intergenic
1198407517 X:136329256-136329278 CCAAATTCTGGTTGTGATTTGGG - Intronic
1198569189 X:137937314-137937336 CAAAATGCTGATAGAAATATGGG + Intergenic
1198588470 X:138149197-138149219 CAAAATGCTGATAGAAATATGGG + Intergenic
1198846642 X:140919154-140919176 CAACAGGCCAGTAGTGATATGGG - Intergenic
1199156840 X:144559771-144559793 CTAAATGGTGTTATTGATATGGG - Intergenic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic
1201317307 Y:12660431-12660453 TAAAATGGTGGTAGTAACATCGG + Intergenic
1201643935 Y:16206462-16206484 CAAAATGCTGGTGGTGTTACTGG - Intergenic
1201658880 Y:16378859-16378881 CAAAATGCTGGTGGTGTTACTGG + Intergenic