ID: 1136663986

View in Genome Browser
Species Human (GRCh38)
Location 16:31792436-31792458
Sequence TGGACATGGGTCAGTCCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 75}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136663986_1136663992 0 Left 1136663986 16:31792436-31792458 CCAATAGGACTGACCCATGTCCA 0: 1
1: 0
2: 0
3: 6
4: 75
Right 1136663992 16:31792459-31792481 GCTTAAGGGCTTAGAAAAGCAGG 0: 1
1: 1
2: 1
3: 11
4: 136
1136663986_1136663993 30 Left 1136663986 16:31792436-31792458 CCAATAGGACTGACCCATGTCCA 0: 1
1: 0
2: 0
3: 6
4: 75
Right 1136663993 16:31792489-31792511 GAACAACCTGCACCTGATTCTGG 0: 2
1: 0
2: 0
3: 12
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136663986 Original CRISPR TGGACATGGGTCAGTCCTAT TGG (reversed) Intronic
903972941 1:27130966-27130988 TGGGCATGGGGCACTTCTATGGG - Intronic
909494936 1:76268021-76268043 TGGAGATCTGTGAGTCCTATAGG - Intronic
912525082 1:110276686-110276708 TTGGCATGTGTTAGTCCTATAGG + Intronic
1071331690 10:84566735-84566757 GGGACATGGGACACTTCTATTGG + Intergenic
1071585348 10:86815133-86815155 TTGCCATGGGTCAGTTTTATTGG + Intronic
1082633135 11:55563759-55563781 TGGGCATGGGGCAGTTTTATAGG - Intergenic
1086955738 11:92933246-92933268 TGGACATGCCTCAGGCCTAAAGG + Intergenic
1088470596 11:110184599-110184621 TGGAGATGGGAAAGTCCTAGAGG + Intronic
1089544275 11:119210908-119210930 TGTACACGGTTCAGTACTATTGG - Intronic
1092260870 12:6952662-6952684 TGGGGATGGGTCTGTCCTGTGGG + Intronic
1093816676 12:23557686-23557708 TGGACATGGGCCAGGCACATTGG + Intronic
1096098664 12:48955999-48956021 GGGACATGGGACAGTGTTATGGG - Intronic
1113754324 13:112799418-112799440 TGGAGGTGGGGCAGTTCTATAGG + Intronic
1126062145 15:44792978-44793000 TGGACATGGGTCATTTCTCACGG - Intergenic
1130206886 15:81885351-81885373 GTGGAATGGGTCAGTCCTATCGG - Intergenic
1133507390 16:6425494-6425516 TGTATAAGGGTCAGTCTTATAGG + Intronic
1133855579 16:9546446-9546468 GGGACATGGGTGTGTCCTACAGG + Intergenic
1134740483 16:16538956-16538978 TGAACATGAGTCCCTCCTATGGG - Intergenic
1134825598 16:17281838-17281860 TGGACCTGGGTCAGTCCCTCTGG + Intronic
1134927021 16:18173216-18173238 TGAACATGAGTCCCTCCTATGGG + Intergenic
1135791594 16:25401549-25401571 TGGGGATGGGTCAATCTTATTGG + Intergenic
1136640985 16:31564888-31564910 TGGACATGGCTCACTCCTACTGG + Intergenic
1136663986 16:31792436-31792458 TGGACATGGGTCAGTCCTATTGG - Intronic
1136774634 16:32865247-32865269 TGGACTTGGGGCAGCCCTTTGGG + Intergenic
1136895978 16:33996267-33996289 TGGACTTGGGGCAGCCCTTTGGG - Intergenic
1138463187 16:57165946-57165968 TGGACCTGGGTCAGTTTTACTGG - Intronic
1141336794 16:83163521-83163543 TGGACATGGGTGAGTGCCAATGG - Intronic
1203077061 16_KI270728v1_random:1127383-1127405 TGGACTTGGGGCAGCCCTTTGGG + Intergenic
1151413748 17:73948126-73948148 TGGACATGGGACAGGCTTACTGG + Intergenic
1156782730 18:40870618-40870640 TGGAAATGGCTCACTCCAATGGG - Intergenic
1160049958 18:75423698-75423720 TGGGCTTGAGTCAGTGCTATTGG - Intronic
1160922135 19:1526006-1526028 TGGGCATGGGTGAGTCCAAGGGG - Intronic
1162650831 19:12087743-12087765 TGCTCATGGGTGACTCCTATTGG + Intergenic
1164624386 19:29716490-29716512 TGGAAAAGGGTCCGTCCTCTGGG - Intergenic
926695562 2:15767978-15768000 TGGACATGCCTCAGTCCTGGGGG - Intergenic
930013868 2:46957612-46957634 GGGACATGGGTCAGTGATGTAGG + Intronic
930770165 2:55122609-55122631 CACACATGGGTCAGTCCTATGGG + Intergenic
947581260 2:231320327-231320349 TGCAAATGGGTCAGCCCTTTGGG - Intronic
948995082 2:241573928-241573950 TGGACATGGGGCAGTCGTTCTGG + Exonic
1172263428 20:33589555-33589577 TTGTCATGGGTCTGTACTATAGG + Intronic
1176141974 20:63548807-63548829 TGGACACTGGTCACGCCTATTGG - Intronic
1185058804 22:48594909-48594931 GGGACATGGGGCAGTCCCAAGGG - Intronic
952525906 3:34210476-34210498 TGGACATGGGTCATTTCTCACGG + Intergenic
957922805 3:86768472-86768494 TGGACATGTATCAGTCTTTTTGG - Intergenic
962658549 3:137575574-137575596 TGTATATGGGTCATTCCTTTTGG + Intergenic
963295488 3:143541626-143541648 TGGACATGGGTCATTGCTCAAGG - Intronic
963874830 3:150463315-150463337 TTGACATAGGTCAGTCCTGCAGG + Exonic
966187047 3:177236779-177236801 TAGACATGGGTAAGCCCTAATGG - Intergenic
968041471 3:195592732-195592754 TGGACATGGCTCAGTCCAAGAGG - Intergenic
969229042 4:5816937-5816959 TGGACAGGAGTCAGTTCTCTAGG - Intronic
978523147 4:109637221-109637243 GGGAAATGTGTCAGCCCTATGGG + Intronic
979152166 4:117332764-117332786 TGGACATGAATAAATCCTATGGG - Intergenic
982743086 4:159078424-159078446 TGGAAATGGCTCTGTCCTAAGGG + Intergenic
986556108 5:9011112-9011134 TGGACATGGCTCTACCCTATGGG + Intergenic
987844572 5:23265832-23265854 TGGACAGGGGTCACTCCTTGAGG + Intergenic
987968106 5:24903081-24903103 TGGACATGGGTGTGTCATCTAGG - Intergenic
988331956 5:29852766-29852788 TGGAGATGGATCAGGACTATTGG + Intergenic
989131533 5:38111976-38111998 TGGACATAGGTCTGTCCCTTAGG + Intergenic
992142835 5:73816737-73816759 TGGACATGGGTCATTTCCAAAGG - Intronic
993054139 5:82961670-82961692 TGGACATGGGGCAGCCTTCTGGG + Intergenic
997668795 5:135653687-135653709 TGGAGATTGGTCTGTCTTATGGG - Intergenic
1001048548 5:168395220-168395242 TGGACATGGGTCTGTACTGTGGG - Intronic
1001881431 5:175247857-175247879 TGGACATGGACCATTCCTTTGGG - Intergenic
1006991508 6:38218598-38218620 TGGACATGGGCCACACCTACTGG - Intronic
1018966289 6:168492024-168492046 TGAACATGGCTCAGTCTTACTGG + Intronic
1023323140 7:39022490-39022512 AAGACATGGGACACTCCTATGGG + Intronic
1028422396 7:90648454-90648476 TCCACACAGGTCAGTCCTATTGG + Intronic
1035362827 7:158324768-158324790 TGGTTCTGGGTCAGTGCTATGGG - Intronic
1035599831 8:890974-890996 AGGACCTGGGTCAGTGCTATTGG + Intergenic
1036978007 8:13436443-13436465 TGAAAACGGGTCAGTCCTTTTGG - Intronic
1039017698 8:33170728-33170750 TGGACACTGGTCAGTCTTTTAGG - Intergenic
1039313588 8:36346898-36346920 TCCAGATGGGTCATTCCTATTGG - Intergenic
1041823902 8:62069339-62069361 AGGACAGAGGTCAGTCCTCTGGG - Intergenic
1045131208 8:99155437-99155459 GGGACATGGGACAGTCTCATAGG + Intronic
1047621962 8:126617062-126617084 TGGCCATGGGTCAGTCCAAAAGG + Intergenic
1047675418 8:127196613-127196635 AAGTCATGGATCAGTCCTATTGG - Intergenic
1051991421 9:23156869-23156891 TGGACATGCTGCAGCCCTATGGG - Intergenic
1186456984 X:9717427-9717449 TGGACAAGGGTCAGTCTTCGGGG + Exonic
1187757670 X:22545368-22545390 TGGCCATGAGTCAGTTCTCTGGG + Intergenic
1188282342 X:28285905-28285927 TTGACATGGGTCAGTACGCTTGG + Intergenic
1191199315 X:57762332-57762354 ACTACATGGGTAAGTCCTATCGG - Intergenic
1200105308 X:153708808-153708830 TGGACTTGGGGCAGCCCTTTGGG - Intronic