ID: 1136663986 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:31792436-31792458 |
Sequence | TGGACATGGGTCAGTCCTAT TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 82 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 6, 4: 75} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1136663986_1136663992 | 0 | Left | 1136663986 | 16:31792436-31792458 | CCAATAGGACTGACCCATGTCCA | 0: 1 1: 0 2: 0 3: 6 4: 75 |
||
Right | 1136663992 | 16:31792459-31792481 | GCTTAAGGGCTTAGAAAAGCAGG | 0: 1 1: 1 2: 1 3: 11 4: 136 |
||||
1136663986_1136663993 | 30 | Left | 1136663986 | 16:31792436-31792458 | CCAATAGGACTGACCCATGTCCA | 0: 1 1: 0 2: 0 3: 6 4: 75 |
||
Right | 1136663993 | 16:31792489-31792511 | GAACAACCTGCACCTGATTCTGG | 0: 2 1: 0 2: 0 3: 12 4: 86 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1136663986 | Original CRISPR | TGGACATGGGTCAGTCCTAT TGG (reversed) | Intronic | ||