ID: 1136663986

View in Genome Browser
Species Human (GRCh38)
Location 16:31792436-31792458
Sequence TGGACATGGGTCAGTCCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 75}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136663986_1136663992 0 Left 1136663986 16:31792436-31792458 CCAATAGGACTGACCCATGTCCA 0: 1
1: 0
2: 0
3: 6
4: 75
Right 1136663992 16:31792459-31792481 GCTTAAGGGCTTAGAAAAGCAGG 0: 1
1: 1
2: 1
3: 11
4: 136
1136663986_1136663993 30 Left 1136663986 16:31792436-31792458 CCAATAGGACTGACCCATGTCCA 0: 1
1: 0
2: 0
3: 6
4: 75
Right 1136663993 16:31792489-31792511 GAACAACCTGCACCTGATTCTGG 0: 2
1: 0
2: 0
3: 12
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136663986 Original CRISPR TGGACATGGGTCAGTCCTAT TGG (reversed) Intronic