ID: 1136663993

View in Genome Browser
Species Human (GRCh38)
Location 16:31792489-31792511
Sequence GAACAACCTGCACCTGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 2, 1: 0, 2: 0, 3: 12, 4: 86}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136663991_1136663993 10 Left 1136663991 16:31792456-31792478 CCAGCTTAAGGGCTTAGAAAAGC 0: 1
1: 1
2: 0
3: 12
4: 103
Right 1136663993 16:31792489-31792511 GAACAACCTGCACCTGATTCTGG 0: 2
1: 0
2: 0
3: 12
4: 86
1136663989_1136663993 17 Left 1136663989 16:31792449-31792471 CCCATGTCCAGCTTAAGGGCTTA 0: 1
1: 0
2: 2
3: 4
4: 70
Right 1136663993 16:31792489-31792511 GAACAACCTGCACCTGATTCTGG 0: 2
1: 0
2: 0
3: 12
4: 86
1136663986_1136663993 30 Left 1136663986 16:31792436-31792458 CCAATAGGACTGACCCATGTCCA 0: 1
1: 0
2: 0
3: 6
4: 75
Right 1136663993 16:31792489-31792511 GAACAACCTGCACCTGATTCTGG 0: 2
1: 0
2: 0
3: 12
4: 86
1136663990_1136663993 16 Left 1136663990 16:31792450-31792472 CCATGTCCAGCTTAAGGGCTTAG 0: 2
1: 0
2: 1
3: 5
4: 102
Right 1136663993 16:31792489-31792511 GAACAACCTGCACCTGATTCTGG 0: 2
1: 0
2: 0
3: 12
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136663993 Original CRISPR GAACAACCTGCACCTGATTC TGG Intronic
902723631 1:18321216-18321238 GCACAACCTGCCTCTGCTTCTGG - Intronic
903598061 1:24511896-24511918 GGCCAAACTGCACCTAATTCAGG + Intronic
903918273 1:26780285-26780307 CAACAATGTGGACCTGATTCTGG + Exonic
907270883 1:53290432-53290454 GAAGAACCTGCAGCAGACTCAGG + Intronic
908423347 1:63981065-63981087 GAACAACATCAAACTGATTCAGG - Intronic
912962749 1:114210426-114210448 GAACCATCTGTACCTGGTTCTGG + Intergenic
1064416479 10:15154363-15154385 ACACAGCCTGCACCTGAGTCAGG - Intronic
1065735704 10:28750182-28750204 GAACAACCTGCTCCTGAATTGGG - Intergenic
1068902947 10:62290385-62290407 GAACAACCTGCCTCTCACTCTGG + Intergenic
1070679456 10:78438418-78438440 GAACAAAGTGCAGCTGGTTCTGG + Intergenic
1071752729 10:88499427-88499449 AAACAACCTGCCCCAGATTCAGG + Intronic
1074308362 10:112299681-112299703 GCACAACCTTCACCTGCTCCTGG + Intronic
1075282816 10:121155067-121155089 GAGCAACAGGCACGTGATTCTGG + Intergenic
1078822647 11:14897520-14897542 GAACAACCTGGGCCTGTATCTGG + Intergenic
1080638495 11:34143967-34143989 GAGAAACCTGGACTTGATTCTGG - Intronic
1080782505 11:35443225-35443247 GAACATCCTGCACCTGTATCCGG - Intronic
1088926486 11:114308160-114308182 GAATATCATTCACCTGATTCGGG + Intronic
1089320364 11:117622352-117622374 GTACAACCTGCCCCTGCTCCTGG - Intronic
1092913574 12:13169376-13169398 GAACAACCTGCTCCTGGTGTGGG + Intergenic
1093767060 12:22976501-22976523 GAACAACATGAACCAGATCCAGG - Intergenic
1101346028 12:103886901-103886923 GATCTACCTGAACTTGATTCTGG - Intergenic
1101354414 12:103964016-103964038 CAACATCCTGCATCTGAGTCTGG - Intronic
1102970567 12:117162849-117162871 GAACAGCCTGCACGTGGTCCAGG - Intronic
1108250757 13:48565403-48565425 CACCAAACTGCACCTGAGTCGGG + Intergenic
1112667124 13:101588036-101588058 GAAACACCTGCACCTGTTTCTGG + Intronic
1114163020 14:20190250-20190272 GAAAGACCTGCACCTGCATCAGG + Intergenic
1123463907 15:20499730-20499752 GATCAACCTGCAACTGATGATGG - Intergenic
1123654156 15:22500693-22500715 GATCAACCTGCAACTGATGATGG + Intergenic
1124047793 15:26166282-26166304 GAATGACCTGCAGTTGATTCTGG - Intergenic
1124308063 15:28595889-28595911 GATCAACCTGCAACTGATGATGG + Intergenic
1127302233 15:57666312-57666334 GAACACCCTCTACCTGATCCTGG + Intronic
1128234104 15:66055795-66055817 GAACAACCTCAACATGATTCGGG + Intronic
1128480269 15:68031414-68031436 GAGCACCCTGAAGCTGATTCTGG + Intergenic
1131093648 15:89642196-89642218 GACTAACCTGCACCTGGCTCTGG + Exonic
1131343116 15:91621453-91621475 GAACAGCCTGCCCCTGAGCCTGG + Intergenic
1131891422 15:96975817-96975839 GAACAGCCTTCACCAGATGCTGG + Intergenic
1132234413 15:100208284-100208306 GAACAAGCAGCACATGTTTCTGG - Intronic
1132546170 16:534389-534411 GAGCGGCCTGCACCTGTTTCTGG + Intronic
1134151658 16:11810138-11810160 GTAAAACCTGGACCTGACTCTGG + Intergenic
1136390827 16:29963164-29963186 GCACAACCTGCACCTGTGTCTGG + Exonic
1136640979 16:31564835-31564857 GAACAACCTGCACCTGATTCTGG - Intergenic
1136663993 16:31792489-31792511 GAACAACCTGCACCTGATTCTGG + Intronic
1138956225 16:61973539-61973561 TAACCACATGCACCTGATTCAGG - Intronic
1139089581 16:63629124-63629146 GAAATACCAGCACCTGCTTCTGG - Intergenic
1141006296 16:80355984-80356006 GAAGCAACTGCACATGATTCAGG + Intergenic
1143085772 17:4414931-4414953 GAACATCCTCCACCTGATACAGG - Intergenic
1146974103 17:37096352-37096374 GAACATCCTGCAACTGTTTCAGG - Intronic
1147001513 17:37366223-37366245 GAAAAACCTGAACCTGATATAGG - Intronic
1147575056 17:41594196-41594218 TAACAACCTGAACATGACTCTGG - Intergenic
1152989153 18:346982-347004 CAACAACCTGAACCTGACCCAGG - Exonic
1156146061 18:34180474-34180496 AAACATCCTCCACCTGATTAAGG + Intronic
1163212381 19:15850704-15850726 GAAAAACCTGAACCTAGTTCAGG + Intergenic
1164463304 19:28466579-28466601 GAACTGCCTGCATCTGGTTCTGG + Intergenic
925060860 2:889008-889030 TAACAACCTGCCCCTGACTCTGG - Intergenic
935321324 2:101891964-101891986 GAACCATCTGCACATGATTTAGG - Intronic
935594047 2:104866251-104866273 GAGCAGCCTGCACCTGAAACGGG + Intergenic
935595846 2:104876925-104876947 GAACACCCAGCACCTCAGTCTGG + Intergenic
936752957 2:115668433-115668455 GAACAAACCCCACCAGATTCTGG + Intronic
937450640 2:121999741-121999763 GATCAAGCTTCACCTGAATCAGG - Intergenic
939165694 2:138639086-138639108 CAGCACCCTCCACCTGATTCTGG + Intergenic
944294203 2:198043599-198043621 TATGAACCTCCACCTGATTCTGG - Intronic
947066691 2:226234742-226234764 GAACATCCTGCCCCTTCTTCAGG - Intergenic
947480922 2:230499259-230499281 GTACAACTTGCAGATGATTCTGG + Intronic
1171412995 20:24958984-24959006 GAAAAACCAGCACCTGCGTCTGG + Exonic
1174899816 20:54487292-54487314 GAACACTCTGCACCTAAGTCAGG - Intronic
1176361903 21:6004690-6004712 GAACATCCTGAACCAGATTAGGG - Intergenic
1179761615 21:43533855-43533877 GAACATCCTGAACCAGATTAGGG + Intronic
1182205825 22:28625066-28625088 GAATATCCTCCACCTGATTAAGG + Intronic
1182428830 22:30288764-30288786 GAAGAACTTGCACCTGGTTGGGG + Exonic
1183367327 22:37413861-37413883 GAAGAACTTGGACCTGACTCTGG - Intronic
951580977 3:24162085-24162107 GAACAGCCTGCATCTGCATCTGG - Intronic
962893983 3:139697805-139697827 GAGCCTCCTGCACCTGACTCTGG + Intergenic
963250577 3:143099367-143099389 AAACACCCTCCAGCTGATTCTGG - Intergenic
971019199 4:22516656-22516678 GAACAATCTGAAGCTGTTTCTGG + Intergenic
976561347 4:86505102-86505124 GTTCAACCTTCACCTGTTTCTGG + Intronic
985678578 5:1244592-1244614 GCAGAACCTGCACCAGATGCTGG - Exonic
988177998 5:27752600-27752622 GAATAACCTGCTCCTGAATGAGG + Intergenic
998794375 5:145802610-145802632 AGACAACCTTCACCTGATTGTGG + Intronic
1001136394 5:169106174-169106196 GCACATCCTGCACCTGAACCCGG + Intronic
1003108589 6:3234484-3234506 GAACAATCTGCTCCTGCTTCAGG - Intronic
1003365780 6:5473563-5473585 GAATACCCTGCTCCTGATTCAGG + Intronic
1003713871 6:8623620-8623642 GTCCTACCTGCATCTGATTCAGG + Intergenic
1011939162 6:92821278-92821300 GAACAACCTGCATGTGATAGAGG + Intergenic
1016908312 6:149172868-149172890 GAACAAGCTGCACTTGAGCCGGG + Intergenic
1020524044 7:9235635-9235657 GAACAACGTGCAACTGATCTGGG + Intergenic
1021403985 7:20242908-20242930 AAACAACCTGCATCTGATAATGG - Intergenic
1022537628 7:31107690-31107712 GAAGCACCTGCACCCGAATCTGG + Exonic
1023170541 7:37386537-37386559 AAACTACCTGCACCTGGTCCTGG + Intronic
1026415529 7:70176353-70176375 AGACATCCTGCTCCTGATTCTGG - Intronic
1028269942 7:88776066-88776088 GAACAACCTGAGCCTGATAATGG - Intronic
1034229904 7:149515245-149515267 AAATAACCTGCACCTGAATTTGG - Intergenic
1037025416 8:14029652-14029674 GAACAACATTTACCTGAATCTGG + Intergenic
1037618834 8:20545221-20545243 GAAAAGCCTGCAACAGATTCCGG + Intergenic
1048644711 8:136407117-136407139 GAACAGTCTGCCCCAGATTCAGG + Intergenic
1057147386 9:92767548-92767570 GCAACACCTGCACCTGATCCAGG + Intergenic
1189074941 X:37905527-37905549 GAGCCAGCTGCACCTGTTTCTGG + Intronic
1192153074 X:68724006-68724028 GAACAACCTGTGCCAGAGTCGGG + Exonic
1199518149 X:148702523-148702545 GAACCACCTGTGCCTGATTGCGG - Intronic
1199602396 X:149549862-149549884 GTACAAAATGCTCCTGATTCTGG - Intronic
1199647992 X:149929613-149929635 GTACAAAATGCTCCTGATTCTGG + Intronic