ID: 1136666716

View in Genome Browser
Species Human (GRCh38)
Location 16:31819350-31819372
Sequence CCCTCCGGGGAAGCGCAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136666705_1136666716 25 Left 1136666705 16:31819302-31819324 CCGGAATCGGAATCTCCTTAATT No data
Right 1136666716 16:31819350-31819372 CCCTCCGGGGAAGCGCAGCCCGG No data
1136666708_1136666716 10 Left 1136666708 16:31819317-31819339 CCTTAATTTGCACTGGGCTCTGG No data
Right 1136666716 16:31819350-31819372 CCCTCCGGGGAAGCGCAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136666716 Original CRISPR CCCTCCGGGGAAGCGCAGCC CGG Intergenic