ID: 1136666979

View in Genome Browser
Species Human (GRCh38)
Location 16:31820496-31820518
Sequence GGTGCATGACTTCCTTCCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136666979_1136666987 14 Left 1136666979 16:31820496-31820518 CCACGGGAAGGAAGTCATGCACC No data
Right 1136666987 16:31820533-31820555 CTTTAGAAAAATGATACTGAGGG No data
1136666979_1136666989 24 Left 1136666979 16:31820496-31820518 CCACGGGAAGGAAGTCATGCACC No data
Right 1136666989 16:31820543-31820565 ATGATACTGAGGGCCAGGCGCGG No data
1136666979_1136666988 19 Left 1136666979 16:31820496-31820518 CCACGGGAAGGAAGTCATGCACC No data
Right 1136666988 16:31820538-31820560 GAAAAATGATACTGAGGGCCAGG No data
1136666979_1136666986 13 Left 1136666979 16:31820496-31820518 CCACGGGAAGGAAGTCATGCACC No data
Right 1136666986 16:31820532-31820554 CCTTTAGAAAAATGATACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136666979 Original CRISPR GGTGCATGACTTCCTTCCCG TGG (reversed) Intergenic
No off target data available for this crispr