ID: 1136669147

View in Genome Browser
Species Human (GRCh38)
Location 16:31839949-31839971
Sequence GAGGCTAGGTCTTCGAGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136669147_1136669160 26 Left 1136669147 16:31839949-31839971 CCACCCCTCGAAGACCTAGCCTC No data
Right 1136669160 16:31839998-31840020 CAGACTATCCCCTATGGACCAGG No data
1136669147_1136669158 20 Left 1136669147 16:31839949-31839971 CCACCCCTCGAAGACCTAGCCTC No data
Right 1136669158 16:31839992-31840014 AGCTTCCAGACTATCCCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136669147 Original CRISPR GAGGCTAGGTCTTCGAGGGG TGG (reversed) Intergenic
No off target data available for this crispr