ID: 1136669978

View in Genome Browser
Species Human (GRCh38)
Location 16:31847514-31847536
Sequence TTTATTAGGAAGGAAATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136669972_1136669978 24 Left 1136669972 16:31847467-31847489 CCACACATTAATGAGAAGTTCAC No data
Right 1136669978 16:31847514-31847536 TTTATTAGGAAGGAAATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136669978 Original CRISPR TTTATTAGGAAGGAAATGGA GGG Intergenic
No off target data available for this crispr