ID: 1136670745

View in Genome Browser
Species Human (GRCh38)
Location 16:31854882-31854904
Sequence CAGATGACAGCAGTGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136670745_1136670755 3 Left 1136670745 16:31854882-31854904 CCATCCACCACTGCTGTCATCTG No data
Right 1136670755 16:31854908-31854930 ACTCTTGGGGTCCTAAGGATGGG No data
1136670745_1136670753 -2 Left 1136670745 16:31854882-31854904 CCATCCACCACTGCTGTCATCTG No data
Right 1136670753 16:31854903-31854925 TGGGTACTCTTGGGGTCCTAAGG No data
1136670745_1136670752 -10 Left 1136670745 16:31854882-31854904 CCATCCACCACTGCTGTCATCTG No data
Right 1136670752 16:31854895-31854917 CTGTCATCTGGGTACTCTTGGGG No data
1136670745_1136670754 2 Left 1136670745 16:31854882-31854904 CCATCCACCACTGCTGTCATCTG No data
Right 1136670754 16:31854907-31854929 TACTCTTGGGGTCCTAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136670745 Original CRISPR CAGATGACAGCAGTGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr