ID: 1136671648

View in Genome Browser
Species Human (GRCh38)
Location 16:31863963-31863985
Sequence TTGTGGACTCTGATGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136671645_1136671648 28 Left 1136671645 16:31863912-31863934 CCAGAGTCAGACATCAATGAAGA 0: 1
1: 0
2: 4
3: 10
4: 146
Right 1136671648 16:31863963-31863985 TTGTGGACTCTGATGGAACATGG 0: 1
1: 0
2: 1
3: 45
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136671648 Original CRISPR TTGTGGACTCTGATGGAACA TGG Intergenic
902184802 1:14717194-14717216 ATGTGGACTCTGTAGGCACAGGG + Intronic
903179171 1:21596945-21596967 CTCTGGACTCAGAGGGAACAAGG - Intronic
904419485 1:30382450-30382472 TCGGGGACTCGGAAGGAACAGGG - Intergenic
910188910 1:84574746-84574768 TTGTGGAGTCTGAAGGTACAAGG + Intergenic
912229050 1:107771207-107771229 TTCTGGAATCTGATGGAATTGGG + Intronic
913348061 1:117827832-117827854 TTGTTCTCTCTGATGGAAGAAGG + Intergenic
918248502 1:182681354-182681376 CTGTAGACTCTGATGGCAAATGG - Intronic
918656135 1:187028192-187028214 TTGTGGACTCTGGGATAACAGGG - Intergenic
918835474 1:189459005-189459027 TTTTTGACATTGATGGAACAGGG - Intergenic
919819545 1:201464482-201464504 TTGTGGACTCTGAGGGACTGGGG + Intergenic
920167618 1:204046717-204046739 TTGTGGAGGCTGATGGAGAAAGG + Intergenic
922073365 1:222218055-222218077 TTCTGGACTCTGGTGGGAAAGGG - Intergenic
1066804435 10:39231044-39231066 TTGTGGTCTATGGTGAAACAGGG + Intergenic
1066811878 10:39349624-39349646 TTGTGGCCTATGGTGGAAAAGGG - Intergenic
1066816358 10:39420767-39420789 TTGAGGACTATGGTGGAAAAGGG + Intergenic
1066921509 10:41505637-41505659 TTGTGTACTTTGTTGGAAGAGGG + Intergenic
1066921611 10:41507674-41507696 TTGTGTACTTTGTTGGAAGAGGG + Intergenic
1066923271 10:41540244-41540266 TTGTGTACTTTGTTGGAAGAGGG + Intergenic
1068049737 10:51934576-51934598 TTGTGGTCTCTCAGGGACCAAGG + Intronic
1068843378 10:61641221-61641243 TTCTGGACTCTGCTGTAACCAGG - Intergenic
1070667538 10:78356050-78356072 TTTTGGACTCTTCTAGAACATGG + Intergenic
1073152129 10:101319279-101319301 TTGTGAACTCTGTAAGAACAGGG + Intergenic
1074427762 10:113367307-113367329 TTTTGGACACCCATGGAACATGG + Intergenic
1079975471 11:27085603-27085625 TTGTTGTCTCTCAGGGAACAGGG - Intronic
1080826761 11:35855123-35855145 TGATGGATTCTGATGGAGCAGGG - Intergenic
1081192352 11:40119489-40119511 CTGTGGACTCTGTGAGAACAGGG + Intronic
1081907023 11:46676705-46676727 GTGTGGACTGTGATGGACAATGG - Intergenic
1082318801 11:50769857-50769879 TTGTGGCCTATGTTGGAAAAGGG - Intergenic
1082547145 11:54346200-54346222 TTGTGGACTGTGGTGGAAAAGGG + Intergenic
1082547451 11:54350295-54350317 TTGTGGACTGTGGTGGAAAAGGG + Intergenic
1082547760 11:54354387-54354409 TTGTGGACTGTGGTGGAAAAGGG + Intergenic
1082547920 11:54356435-54356457 TTGTGGACTGTGGTGGAAAAGGG + Intergenic
1082548076 11:54358482-54358504 TTGTGGACTGTGGTGGAAAAGGG + Intergenic
1082548230 11:54360529-54360551 TTGTGGACTGTGGTGGAAAAGGG + Intergenic
1082548387 11:54362576-54362598 TTGTGGACTGTGGTGGAAAAGGG + Intergenic
1082548543 11:54364622-54364644 TTGTGGACTGTGGTGGAAAAGGG + Intergenic
1082548860 11:54368718-54368740 TTGTGGACTGTGGTGGAAAAGGG + Intergenic
1082548938 11:54369743-54369765 TTGTGGACTGTGGTGGAAAAGGG + Intergenic
1082549250 11:54373836-54373858 TTGTGGACTGTGGTGGAAAAGGG + Intergenic
1082549549 11:54377931-54377953 TTGTGGACTGTGGTGGAAAAGGG + Intergenic
1082549997 11:54384074-54384096 TTGTGGACTGTGGTGGAAAAGGG + Intergenic
1082550143 11:54386121-54386143 TTGTGGACTGTGGTGTAAAAGGG + Intergenic
1082550767 11:54394312-54394334 TTGTGGACTGTGGTGGAAAAGGG + Intergenic
1082550915 11:54396360-54396382 TTGTGGACTGTGGTGGAAAAGGG + Intergenic
1082551066 11:54398408-54398430 TTGTGGACTGTGGTGGAAAAGGG + Intergenic
1082551217 11:54400456-54400478 TTGTGGACTGTGGTGGAAAAGGG + Intergenic
1082551376 11:54402504-54402526 TTGTGGACTGTGGTGGAAAAGGG + Intergenic
1082551533 11:54404553-54404575 TTGTGGACTGTGGTGGAAAAGGG + Intergenic
1082551996 11:54410695-54410717 TTGTGGACTGTGGTGGAAAAGGG + Intergenic
1082552157 11:54412744-54412766 TTGTGGACTGTGGTGGAAAAGGG + Intergenic
1082552309 11:54414789-54414811 TTGTGGACTGTGGTGGAAAAGGG + Intergenic
1082552457 11:54416837-54416859 TTGTGGACTGTGGTGGAAAAGGG + Intergenic
1082552764 11:54420930-54420952 TTGTGGACTGTGGTGGAAAAGGG + Intergenic
1082552924 11:54422978-54423000 TTGTGGACTGTGGTGGAAAAGGG + Intergenic
1082553118 11:54525595-54525617 TTGTGGACTGTGGTGTAAAAGGG + Intergenic
1082553271 11:54527642-54527664 TTGTGGACTGTGGTGGAAAAGGG + Intergenic
1082553427 11:54529690-54529712 TTGTGGACTGTGGTGGAAAAGGG + Intergenic
1082553582 11:54531737-54531759 TTGTGGACTGTGGTGGAAAAGGG + Intergenic
1082553735 11:54533784-54533806 TTGTGGACTGTGGTGGAAAAGGG + Intergenic
1082553892 11:54535829-54535851 TTGTGGACTGTGGTGGAAAAGGG + Intergenic
1083827169 11:65210444-65210466 TTGGGGACACTCACGGAACATGG - Exonic
1083862588 11:65430397-65430419 TTGTGAACTCTGCCGGTACAGGG - Intergenic
1084711063 11:70844040-70844062 TTGGGGACTCAGATGGGACAGGG - Intronic
1088589344 11:111389553-111389575 TTGTGCACTTTGGTGGACCACGG - Intronic
1090572754 11:128066105-128066127 TTGTGCCCTCTGCAGGAACATGG + Intergenic
1090770952 11:129919517-129919539 TTGTTCACTATGATGGAGCATGG + Intronic
1092094171 12:5827991-5828013 TTGAGGACTTTGAGGAAACAAGG + Intronic
1095059026 12:37660696-37660718 TTGAGGCCTATGATGGAAAAGGG + Intergenic
1095918334 12:47503376-47503398 TTGTGTACTTTGGAGGAACATGG + Intergenic
1098424319 12:70342262-70342284 TTAAGTACTCAGATGGAACATGG - Exonic
1099604174 12:84780730-84780752 TTGCTGTCTCAGATGGAACATGG + Intergenic
1104057755 12:125243712-125243734 TTGGGGACTATGACGGAAGAGGG - Intronic
1111359584 13:87158592-87158614 TTGTGGCCTTTGCAGGAACATGG + Intergenic
1111531681 13:89544552-89544574 TTGTGTACTCTGATAGGACTAGG + Intergenic
1113363817 13:109657039-109657061 TTGTTTAATCTGATGGAAGAAGG + Intergenic
1114141707 14:19919196-19919218 TTGTGTACTCTATTGGAAGAAGG - Intergenic
1118501893 14:66369881-66369903 TTGTGCACTTTGCTTGAACAGGG + Intergenic
1118607122 14:67512688-67512710 TTGGGGACTCTGATGTCATAAGG - Intronic
1119911604 14:78354787-78354809 ATGTGCTCTCTGAAGGAACAAGG + Intronic
1120312101 14:82842162-82842184 CTGTGAACTGTGATGAAACAGGG - Intergenic
1129712137 15:77825831-77825853 TTGAGGACTCAGAAGGGACATGG - Intergenic
1131115700 15:89793938-89793960 TTGTGGACTCTGGTTTGACATGG + Intronic
1133198445 16:4187315-4187337 TTATTCACTCTGATGGCACACGG + Intergenic
1133921133 16:10154192-10154214 TTGTGGGCCCAGATGGAGCATGG - Intronic
1136671648 16:31863963-31863985 TTGTGGACTCTGATGGAACATGG + Intergenic
1136915828 16:34195836-34195858 TTGTGGCCTATGGTGGAAAAGGG - Intergenic
1137078259 16:36005063-36005085 TTGAAGACTATGATTGAACAGGG + Intergenic
1137869175 16:51933113-51933135 TTATGGAATGTGATGGCACATGG + Intergenic
1139959817 16:70711054-70711076 ATGAGGACACTGATGGGACAGGG - Intronic
1141518705 16:84563340-84563362 TTGTGAGCTCTCATGGAACCTGG + Intergenic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1146968353 17:37052256-37052278 CTGGAGAATCTGATGGAACAAGG + Intronic
1148991472 17:51670247-51670269 TTGAGGACCCTGCTGGCACATGG - Intronic
1152898665 17:82927891-82927913 TTGCGGACCCTGATGGGACAAGG - Exonic
1153629893 18:7059209-7059231 TTGTGGACTTTATTGGGACAAGG - Intronic
1155071659 18:22322112-22322134 TTGTGGAATCACATGGAAGAAGG + Intergenic
1157555218 18:48609081-48609103 CTGTGGACTCTGAAGGTAGATGG - Intronic
1158104130 18:53865339-53865361 ATGTGGACTGTGAGGGAACTGGG + Intergenic
1159242359 18:65758621-65758643 TTGTGCACTCTGATAGAACTTGG + Intronic
1160615098 18:80120167-80120189 AAGTGAACTCTGATGGGACATGG - Intronic
1165318045 19:35068645-35068667 CTGGGGACTCTGAGAGAACATGG + Intergenic
1167906268 19:52663401-52663423 ACATGGACTCTGCTGGAACAAGG + Intronic
1167922702 19:52795089-52795111 ATATGGGCTCTGCTGGAACAAGG + Intronic
925045110 2:766987-767009 TGGTGGACTCTCATGGACCCTGG - Intergenic
925802879 2:7618709-7618731 GTGTGAACTCTGATGGGACATGG + Intergenic
928178874 2:29053561-29053583 TTGTTGATTCTGATTGAACCAGG + Exonic
930864333 2:56107977-56107999 TTGGGATCACTGATGGAACAGGG + Intergenic
932132409 2:69199853-69199875 TTGGGGTTTCTGAAGGAACATGG - Intronic
934472573 2:94566539-94566561 TTGTGGACTATGGTAGAAAAGGG - Intergenic
936239924 2:110778522-110778544 TTTTGGAGTCAGATAGAACAGGG + Intronic
939120770 2:138113818-138113840 TTTCAGACTCAGATGGAACATGG + Intergenic
940330847 2:152472943-152472965 TTGGGCACTGTGATGGCACATGG + Intronic
942145405 2:173021894-173021916 TTATGGGCTCTGATGGATGAGGG - Intronic
1169774817 20:9240884-9240906 TTGTCTGCTCTGATGGATCATGG + Intronic
1170822830 20:19768553-19768575 TTTAGGACTCTGAAGGCACAGGG + Intergenic
1171350671 20:24500375-24500397 TTGTGGAAACTCATGGAAAAAGG - Intronic
1171822065 20:29858977-29858999 TTGTGGCCTATGGTGGAAAAAGG + Intergenic
1171825570 20:29900358-29900380 TTGTGGACTATGGTAGAAAAGGG + Intergenic
1171833318 20:30098244-30098266 TTGAGGACTTTGGTGGAAAAGGG + Intergenic
1171911360 20:30960691-30960713 TTGTGGCCTATGGTGGAAAAGGG - Intergenic
1173717636 20:45223472-45223494 TTGGGGACTCTCCAGGAACATGG + Intronic
1176668557 21:9710514-9710536 TTGTGGACTCACATGGATCTTGG + Intergenic
1178354439 21:31898695-31898717 TTGTGGAGTGGGGTGGAACAGGG + Intronic
1178411353 21:32366043-32366065 ATGTGGCTTCTGATGGGACATGG + Intronic
1179020484 21:37636147-37636169 TTGAGGACCCAGATAGAACAGGG - Intronic
1181089061 22:20459590-20459612 TTGGGGGTTCTGATGGATCATGG + Intronic
950632864 3:14294739-14294761 GTGTGTACTCTGATGGATCTGGG + Intergenic
951432826 3:22628084-22628106 TTGTGGACTCTGAGGAATCCAGG - Intergenic
953520732 3:43640197-43640219 TTGTGTGCTTTGAGGGAACAGGG + Intronic
954981888 3:54753431-54753453 TTGTGAACTCTGAAGGTACATGG + Intronic
955492689 3:59499035-59499057 TTTTGAATTCTGATGGAACGTGG + Intergenic
957872832 3:86110345-86110367 TTTTGGACTCTAATAAAACAGGG - Intergenic
963520051 3:146352833-146352855 TTTGGAACTCTAATGGAACAAGG + Intergenic
964903133 3:161685463-161685485 TTGTGACCTCTGAAGGAAAATGG - Intergenic
965043805 3:163548704-163548726 TTTTGGACTATGATTGACCATGG + Intergenic
967446701 3:189575436-189575458 TTGTGGAGTCTGTTGGAAACAGG - Intergenic
969428137 4:7137857-7137879 GAGTGGGCTCTGCTGGAACAGGG + Intergenic
971870403 4:32228876-32228898 TTGTGGACTCTGCTGGAGTATGG - Intergenic
971915068 4:32859025-32859047 TTGCGTACTCTGATGAAGCAAGG + Intergenic
972115692 4:35630893-35630915 TTGTGAAAACTGATGGAACTTGG + Intergenic
973216346 4:47673567-47673589 CTATGGACTCTCATGGAAAATGG - Intronic
983994469 4:174164649-174164671 TTGTGGTCTCTTGTGGATCAAGG - Intergenic
984838002 4:184040210-184040232 TTGTGGAATCCGATGCTACAGGG - Intergenic
985406225 4:189641013-189641035 TTGTGGACTCACATGGATCTTGG - Intergenic
985909791 5:2869847-2869869 TGGTGGGCACTGAAGGAACAAGG + Intergenic
986334054 5:6739820-6739842 TCAAGGACTTTGATGGAACACGG - Exonic
989861446 5:46381746-46381768 TTGAGGTCTCTGGTGGAAAAGGG + Intergenic
989865071 5:46492344-46492366 TTGAGGCCTATGATGGAAAAGGG + Intergenic
989865773 5:46504473-46504495 TTGAGGCCTATGATGGAAAAGGG + Intergenic
989865877 5:46506182-46506204 TTGAGGACTATGATGGAAAAGGG + Intergenic
989867391 5:46532368-46532390 TTGAGGCCTATGATGGAAAAGGG + Intergenic
989867860 5:46540558-46540580 TTGAGGCCTATGATGGAAAAGGG + Intergenic
989868241 5:46547506-46547528 TTGTGACCTATGATGGAAAAGGG + Intergenic
989868319 5:46549041-46549063 TTGAGGACTATGATGGAAAAGGG + Intergenic
989868471 5:46551598-46551620 TTGAGGCCTATGATGGAAAAGGG + Intergenic
989868673 5:46554853-46554875 TTGAGGCCTATGATGGAAAAGGG + Intergenic
989873791 5:46649115-46649137 TTGAGGCCTATGATGGAAAAGGG + Intergenic
989878201 5:46731847-46731869 TTGTGACCTATGATGGAAAAGGG + Intergenic
989881280 5:46789174-46789196 TTGAGGCCTATGATGGAAAAGGG + Intergenic
989885200 5:46866317-46866339 TTGTTGCCTCTGGTGGAAAAAGG + Intergenic
989885711 5:46876375-46876397 TTGTTGCCTCTGGTGGAAAAAGG + Intergenic
989886312 5:46888137-46888159 TTGTTGCCTCTGGTGGAAAAAGG + Intergenic
989888660 5:46934161-46934183 TTGTTGCCTCTGGTGGAAAAAGG + Intergenic
989891280 5:46985805-46985827 TTGTTGCCTCTGGTGGAAAAAGG + Intergenic
989894186 5:47042149-47042171 TTGTTGCCTCTGGTGGAAAAAGG + Intergenic
989897605 5:47113248-47113270 TTGTTGCCTCTGGTGGAAAAAGG + Intergenic
989897826 5:47117338-47117360 TTGTTGCCTCTGGTGGAAAAAGG + Intergenic
989898127 5:47122962-47122984 TTGTTGCCTCTGGTGGAAAAAGG + Intergenic
989898782 5:47135229-47135251 TTGTTGCCTCTGGTGGAAAAAGG + Intergenic
989899176 5:47142385-47142407 TTGTGGTCTAAGATGGAAAAGGG + Intergenic
989899616 5:47150393-47150415 TTGTGGTCTAAGATGGAAAAGGG + Intergenic
989941290 5:50153681-50153703 TTGAGGCCTATGATGGAAAAGGG - Intergenic
989944211 5:50198399-50198421 TTGAGGCCTCTGATGGAAAAGGG - Intergenic
990523171 5:56599492-56599514 TTGTTGAGTCTCAGGGAACAGGG + Intronic
991554991 5:67885899-67885921 TTGGGGACACTGATGGCAGATGG - Intergenic
993512715 5:88791872-88791894 TTGTGGCTTCTGAGGGAAAAGGG - Intronic
993684071 5:90916608-90916630 TTGTGAACGCTGAAGAAACAAGG - Intronic
994565542 5:101441968-101441990 TTTTGGACTCTGATATAATACGG + Intergenic
995143585 5:108761361-108761383 TTGTTGTGTCTCATGGAACAGGG + Intronic
995401104 5:111742672-111742694 TTCTGGGCTTTGATGGTACATGG + Intronic
997694300 5:135849498-135849520 TGGTGGCCTCTGATGGAAGCTGG - Intronic
999240703 5:150125741-150125763 TCGTGGGCTCGGAGGGAACAGGG + Intronic
999333706 5:150696682-150696704 TTTCTAACTCTGATGGAACACGG - Exonic
1000068124 5:157714125-157714147 TTGTGGAATTAAATGGAACAAGG + Intergenic
1001089346 5:168725965-168725987 CTGGGGACTCTCATGGCACAGGG + Intronic
1002453354 5:179331752-179331774 CTGGGGGCTCTGATAGAACAAGG - Intronic
1003895059 6:10599556-10599578 TGGCGGACTCTGAAGGTACATGG - Intronic
1005199258 6:23324787-23324809 TTGTTCACTTTGATGGAAAAAGG + Intergenic
1005591581 6:27334348-27334370 TTTTGGATGATGATGGAACATGG + Intergenic
1005719269 6:28585043-28585065 TTATGAAATCTGTTGGAACAAGG - Intronic
1008563741 6:52747521-52747543 TTCTGGACTTTCATGGATCATGG - Intergenic
1008568187 6:52789830-52789852 TTCTGGACTTTCATGGATCATGG - Intergenic
1013602224 6:111715580-111715602 TTGTGTACTTTGATGAAGCAAGG + Intronic
1015772267 6:136781302-136781324 TTGTTGACACTGATCGAAAAAGG + Intronic
1016301616 6:142637843-142637865 TTGTGGACTCTGACTCAGCAGGG + Intergenic
1018983442 6:168617517-168617539 TTTAGGACTCTGATGGGCCAGGG + Intronic
1019165631 6:170095877-170095899 TTGGGGATTGTGAGGGAACAAGG + Intergenic
1019951671 7:4378162-4378184 TTGTACTATCTGATGGAACAGGG - Intergenic
1020589410 7:10115489-10115511 ATGTGGAGTCTGAGGGGACAAGG + Intergenic
1023336771 7:39178808-39178830 TTGTTGGCTCTGATGGAAGAAGG + Intronic
1025312850 7:57972258-57972280 TTGTGGCCTATGGTGGAAAATGG - Intergenic
1025315300 7:58016884-58016906 TTGTGGCCTATGGTGGAAAAGGG + Intergenic
1026640614 7:72121971-72121993 CTGTGGAGTTTGCTGGAACATGG - Intronic
1026910590 7:74089628-74089650 TTGTTGACTCTGATGGAATTGGG + Intronic
1028054147 7:86222612-86222634 TTGTGGAGTCTGGAGGAGCATGG + Intergenic
1030987598 7:116260963-116260985 TTGTGGCATCTGATAGAAGATGG + Intergenic
1031790452 7:126095083-126095105 TTATGGACTAAGATGGAAAATGG - Intergenic
1031914697 7:127552084-127552106 GTCTGGACTCTGATGCAAGAGGG + Intergenic
1034719237 7:153273336-153273358 TTGGGTCCTTTGATGGAACAGGG + Intergenic
1037681244 8:21099344-21099366 TTTTGGACTTTGATGCCACATGG + Intergenic
1039943871 8:42113856-42113878 TTGTGTTCTCTCATGGAAGAAGG + Intergenic
1040132498 8:43813685-43813707 TTGAGGCCTCTGAGGAAACATGG + Intergenic
1042805885 8:72770278-72770300 TTGGGGACACAGATGGCACATGG - Intronic
1050303443 9:4282836-4282858 TTGAGGACGCTGATGGAACATGG - Intronic
1053408070 9:37894926-37894948 TTGTGCCCTTTGCTGGAACATGG - Intronic
1057240267 9:93401586-93401608 TTGTTGTGTCTGAAGGAACAGGG - Intergenic
1057699691 9:97354823-97354845 TTTTGGACTCTGAAGGAGGAGGG - Intronic
1057855610 9:98598863-98598885 TGGTGTACTGTGATGGAACAGGG - Intronic
1203355573 Un_KI270442v1:136711-136733 TTGTGGCCTATGATGGAAAAGGG - Intergenic
1203408715 Un_KI270538v1:73390-73412 TTGAGGCCTATGATGGAAAAGGG - Intergenic
1203408930 Un_KI270538v1:77484-77506 TTGTGACCTATGATGGAAAAGGG - Intergenic
1203409022 Un_KI270538v1:79188-79210 TTGAGGCCTATGATGGAAAAGGG - Intergenic
1203409177 Un_KI270538v1:83926-83948 TTGAGGCCTATGATGGAAAAGGG - Intergenic
1203409387 Un_KI270538v1:89189-89211 TTGAGGCCTATGATGGAAAAGGG - Intergenic
1203657309 Un_KI270753v1:10427-10449 TTGTGGACTCACATGGATCTTGG - Intergenic
1188469146 X:30517706-30517728 TTGTTGACTCTCAGGGAATAGGG - Intergenic
1189298415 X:39935375-39935397 TTTTGGAGTCAGATGGAACTGGG - Intergenic
1189362717 X:40365654-40365676 TTGAGTAATGTGATGGAACAGGG + Intergenic
1189707234 X:43770995-43771017 GTGTTGACTAAGATGGAACATGG - Intronic
1189956724 X:46283247-46283269 TAGTGGACTCAGATGGTAAATGG + Intergenic
1197095753 X:122592677-122592699 ATGTAGCCTCTAATGGAACAAGG + Intergenic
1197353610 X:125406498-125406520 TAGTGGATTTTGAAGGAACATGG - Intergenic
1197444155 X:126528079-126528101 TTGTTGCCTCTGATGGAATAGGG + Intergenic
1198637710 X:138717718-138717740 TTGGGGACTGAGATGGGACATGG - Intronic
1199368210 X:147013769-147013791 TCGTGTTCTTTGATGGAACATGG + Intergenic