ID: 1136672803

View in Genome Browser
Species Human (GRCh38)
Location 16:31873594-31873616
Sequence CGGGTATTACAGCTAATTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 59}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136672803 Original CRISPR CGGGTATTACAGCTAATTAA GGG (reversed) Intergenic
903315970 1:22507164-22507186 AGGGTATTACAGCTACAGAATGG - Intronic
904890832 1:33778409-33778431 GGGGTATAACAGCGAATAAAAGG + Intronic
906540241 1:46579789-46579811 AAGGCCTTACAGCTAATTAAAGG + Intronic
906957798 1:50390176-50390198 TGGGTTTTACATTTAATTAAAGG + Intergenic
913659127 1:120991155-120991177 TGGGAACTACAGTTAATTAATGG - Intergenic
914010491 1:143774280-143774302 TGGGAACTACAGTTAATTAATGG - Intergenic
914167332 1:145186833-145186855 TGGGAACTACAGTTAATTAATGG + Intergenic
914649112 1:149682939-149682961 TGGGAACTACAGTTAATTAATGG - Intergenic
916296999 1:163229987-163230009 CGGGTTTTACATCTAATTGTTGG + Intronic
916703971 1:167327350-167327372 CAGGTATTACAGGTATTAAATGG + Intronic
918706846 1:187674103-187674125 TGTTTATGACAGCTAATTAATGG - Intergenic
919889937 1:201964264-201964286 CCAGTCATACAGCTAATTAATGG - Intronic
922060273 1:222082739-222082761 AGAGTATTACAGCTAATAAATGG - Intergenic
1068546889 10:58357261-58357283 GGGGTATTAAAGATAATTTAAGG - Intronic
1071199545 10:83203767-83203789 GGTGTATTACATGTAATTAATGG + Intergenic
1076599792 10:131650138-131650160 CAAGTAATAAAGCTAATTAAGGG - Intergenic
1082169246 11:48982378-48982400 GTGGTATTACAGTTAATTATAGG + Intergenic
1082796111 11:57379160-57379182 CAGGTAACACAGCTAATAAAAGG + Intronic
1083431135 11:62614004-62614026 TGGGTTTCACAGCTAATAAATGG - Intronic
1092440686 12:8499185-8499207 AGGGTATAACAGATAATTCAAGG - Intergenic
1093247245 12:16754676-16754698 CTGGTTTCACAGCTAATCAATGG + Intergenic
1095776165 12:46012351-46012373 AAGGTCTTACAACTAATTAAAGG + Intergenic
1102058954 12:109917797-109917819 CGTAAATTACAGCTAATTACAGG + Exonic
1106532960 13:30611428-30611450 CTGGGATTACAGCTATTTTAAGG + Intronic
1115946689 14:38669398-38669420 CGGGATGTAAAGCTAATTAATGG + Intergenic
1123428452 15:20192858-20192880 TGGGTATTTAAGATAATTAATGG + Intergenic
1123966359 15:25463583-25463605 CAGGAACTACAGCTAATAAAGGG - Intergenic
1126916727 15:53474192-53474214 CAGGTATAACAGATAATAAATGG - Intergenic
1136656609 16:31713076-31713098 AGGGTATTACAGCTAATTTAAGG - Intergenic
1136672803 16:31873594-31873616 CGGGTATTACAGCTAATTAAGGG - Intergenic
1136855866 16:33656904-33656926 TGGGTATTTAAGATAATTAATGG - Intergenic
1203117451 16_KI270728v1_random:1505383-1505405 TGGGTATTTAAGATAATTAATGG - Intergenic
1153276506 18:3373006-3373028 TGGGGATAACAGCTACTTAATGG + Intergenic
1161523341 19:4738270-4738292 CAGCAATTACAGCTAATAAACGG - Intergenic
925780316 2:7376006-7376028 CAAGTATTATAACTAATTAAAGG - Intergenic
930022483 2:47009701-47009723 GGGATATGAGAGCTAATTAATGG + Intronic
930446815 2:51483916-51483938 CATGGATTACAGCCAATTAAGGG - Intergenic
933474357 2:82770524-82770546 AGAGTATTAGAGCTAATAAATGG + Intergenic
935163617 2:100550305-100550327 CAGGCTTTACAGCTAATAAAGGG - Intergenic
951756770 3:26099277-26099299 CAGGTAATACAATTAATTAAGGG - Intergenic
952365756 3:32673558-32673580 TGAGTATTACAGCTCTTTAAAGG + Intergenic
954189917 3:48951974-48951996 CGTGTATTACAGCTAAAAAAGGG - Intronic
958866484 3:99507228-99507250 ACGGTGTTACAACTAATTAAGGG + Intergenic
960010577 3:112830392-112830414 TGGGTATTACAGGTGAATAATGG - Intronic
960019083 3:112929238-112929260 CGGGTATTACAGATGCATAATGG - Exonic
967289606 3:187906198-187906220 AGAATATTACAGCTAGTTAATGG - Intergenic
967682639 3:192382728-192382750 GGGGTAATACAACTTATTAAAGG - Intronic
972005876 4:34105081-34105103 CAGGAATTACAGGGAATTAATGG - Intergenic
973951247 4:56016386-56016408 AGGGTATAATAACTAATTAAAGG + Intronic
980716853 4:136638706-136638728 TGGGTCTTAAAGCAAATTAAGGG + Intergenic
991045979 5:62223206-62223228 TGGGTATTTAAGATAATTAATGG + Intergenic
992118190 5:73563155-73563177 CAGGTCACACAGCTAATTAATGG - Intronic
1021507362 7:21400527-21400549 CTGGGATTACAGCTATGTAATGG + Intergenic
1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG + Intronic
1022960563 7:35422439-35422461 TGGATATTTCAGCTAATAAAGGG - Intergenic
1024429924 7:49276172-49276194 CTAGTAACACAGCTAATTAATGG + Intergenic
1041543777 8:59017182-59017204 TGTTTATTACAGCTAACTAAAGG - Intronic
1043327055 8:79065313-79065335 CGGGGACTACAGCTATTTGATGG - Intergenic
1044008476 8:86964577-86964599 CAGGGCTTACAGCAAATTAAGGG - Intronic
1062694036 9:137863334-137863356 CGGGTCATACAGCTAGTCAATGG + Intronic
1189052757 X:37663772-37663794 AGGGTATTACAGCCAATCAAAGG - Intronic
1190267839 X:48838664-48838686 AAGTTATTACAGCTTATTAATGG + Intergenic
1194850804 X:98866077-98866099 ATGGTATTACACCTAATCAATGG - Intergenic
1196341108 X:114598926-114598948 CAGGTCATACAGCTAATTATTGG + Intronic