ID: 1136672903

View in Genome Browser
Species Human (GRCh38)
Location 16:31874032-31874054
Sequence GGCCCGGGTGCCCCTACAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 137}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136672903_1136672908 -3 Left 1136672903 16:31874032-31874054 CCCGCTGTAGGGGCACCCGGGCC 0: 1
1: 0
2: 0
3: 22
4: 137
Right 1136672908 16:31874052-31874074 GCCTCCCCGCAGTCAGCCTCGGG 0: 1
1: 0
2: 0
3: 21
4: 225
1136672903_1136672917 21 Left 1136672903 16:31874032-31874054 CCCGCTGTAGGGGCACCCGGGCC 0: 1
1: 0
2: 0
3: 22
4: 137
Right 1136672917 16:31874076-31874098 TCTGGGCCCCGAGTCCCAACTGG 0: 1
1: 0
2: 1
3: 4
4: 100
1136672903_1136672907 -4 Left 1136672903 16:31874032-31874054 CCCGCTGTAGGGGCACCCGGGCC 0: 1
1: 0
2: 0
3: 22
4: 137
Right 1136672907 16:31874051-31874073 GGCCTCCCCGCAGTCAGCCTCGG 0: 1
1: 0
2: 1
3: 15
4: 202
1136672903_1136672915 4 Left 1136672903 16:31874032-31874054 CCCGCTGTAGGGGCACCCGGGCC 0: 1
1: 0
2: 0
3: 22
4: 137
Right 1136672915 16:31874059-31874081 CGCAGTCAGCCTCGGGGTCTGGG 0: 1
1: 0
2: 0
3: 11
4: 105
1136672903_1136672914 3 Left 1136672903 16:31874032-31874054 CCCGCTGTAGGGGCACCCGGGCC 0: 1
1: 0
2: 0
3: 22
4: 137
Right 1136672914 16:31874058-31874080 CCGCAGTCAGCCTCGGGGTCTGG 0: 1
1: 0
2: 1
3: 19
4: 109
1136672903_1136672910 -2 Left 1136672903 16:31874032-31874054 CCCGCTGTAGGGGCACCCGGGCC 0: 1
1: 0
2: 0
3: 22
4: 137
Right 1136672910 16:31874053-31874075 CCTCCCCGCAGTCAGCCTCGGGG 0: 1
1: 0
2: 0
3: 12
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136672903 Original CRISPR GGCCCGGGTGCCCCTACAGC GGG (reversed) Intronic
900174674 1:1286487-1286509 GGCCCTGGTGTCCCTCCAGGGGG - Intronic
900339760 1:2182456-2182478 GTCCCCGGTGCCCCGCCAGCTGG - Intronic
900513408 1:3070550-3070572 GGCCCGGGCGCCTCTTCTGCGGG - Intronic
900539204 1:3194373-3194395 GCGCCGGCTGCCCCCACAGCAGG - Intronic
900874360 1:5331059-5331081 GGGCAGGGTGCCCCCTCAGCAGG - Intergenic
901084783 1:6603630-6603652 GGCCCGGGAGCCCCTAGGGCGGG - Intronic
901567539 1:10131050-10131072 GGCCCGGCTCCTCCTCCAGCTGG + Intronic
902624493 1:17668651-17668673 GGCCAGGGAGCCTCTGCAGCAGG + Intronic
902698410 1:18155586-18155608 GCCCCGGGTGCCCAAAAAGCTGG + Intronic
903975944 1:27150353-27150375 GGCCCGGGAGCCCATAAAGCAGG - Intronic
904618599 1:31762888-31762910 GGCCCGGGCGCCCCTCCCCCCGG + Intronic
904684141 1:32248535-32248557 GGCCCAGGTGCCGCAGCAGCGGG - Exonic
904773955 1:32895519-32895541 GGGCCTGGTGCCCCTACTCCAGG + Intronic
906711623 1:47934485-47934507 GGCCCGCCTGCCCCTCCCGCTGG - Intronic
907520482 1:55020359-55020381 GGACCAGGAGCTCCTACAGCTGG - Intergenic
912320179 1:108705733-108705755 TGGGCGGGTGCCCCTACAACTGG + Intergenic
922574594 1:226653465-226653487 GCCCCTGGTGCCCCTAAAGCTGG + Intronic
1063382054 10:5591668-5591690 GGCCCAGGTGCCCCAAGGGCTGG + Intergenic
1065976359 10:30846276-30846298 GTCCCGGCTGCACCTTCAGCTGG - Intronic
1072477867 10:95780742-95780764 TTCCCTGATGCCCCTACAGCTGG - Intronic
1075444817 10:122505899-122505921 GGCCTGGGTGACCCTGGAGCTGG + Intronic
1075462181 10:122624170-122624192 GGCTCAAGTGCCCCTGCAGCAGG - Intronic
1076998994 11:313270-313292 GGCCTGGGTGCCCCTTCACAGGG - Intronic
1077340193 11:2023028-2023050 GGCCCGAGGGCAGCTACAGCCGG - Intergenic
1077436051 11:2539726-2539748 AGCCTGGGGGCCCCTGCAGCAGG - Intronic
1081620852 11:44618533-44618555 AGCCCGGAAGCCCCTACAGAGGG - Intronic
1081968646 11:47184380-47184402 GCCCCGGGTGACCCTTCAGCCGG + Intronic
1083342565 11:61967917-61967939 CGCCCGGGCGCCCCTAGACCGGG - Intergenic
1083746028 11:64736899-64736921 GGACCTGGTGGCCCTGCAGCTGG - Exonic
1083846078 11:65334274-65334296 GGCCCGGGCGGCCCTACGGCTGG + Intronic
1085512402 11:77095080-77095102 GGCCCCAGGGGCCCTACAGCAGG - Intronic
1091263786 11:134254071-134254093 GGCCCGGGTCCTCCTGCGGCCGG + Intronic
1202823178 11_KI270721v1_random:78217-78239 GGCCCGAGGGCAGCTACAGCCGG - Intergenic
1091582535 12:1798036-1798058 TGCCCGGCTGCCCCCACCGCAGG - Intronic
1092472592 12:8792506-8792528 GGCCCAGCTTTCCCTACAGCAGG + Intergenic
1093345528 12:18035516-18035538 GGCCCAGCTTCGCCTACAGCAGG + Intergenic
1098595826 12:72272581-72272603 GGCCCGGGTGGCCCGCCCGCGGG + Intronic
1101777301 12:107806373-107806395 GACCTGGGTGCCCCTAGAGAAGG + Intergenic
1101938745 12:109083041-109083063 GGGCCGGGAGCCCCCACACCAGG + Exonic
1102881867 12:116491575-116491597 GGCCCCGCTGCCCATCCAGCGGG - Intergenic
1104393895 12:128415201-128415223 GCCCCAGGTCCCCCTTCAGCCGG - Exonic
1104544680 12:129700207-129700229 GCCCCAGGTCCCCCTGCAGCCGG + Exonic
1105699727 13:22926847-22926869 AGCCCGGCTGCCCCGACGGCAGG + Intergenic
1105918484 13:24939422-24939444 GGCCCCTTTGCCTCTACAGCTGG - Intergenic
1112294764 13:98177021-98177043 GGCCCCGGGGCCTCCACAGCTGG - Exonic
1114411202 14:22502134-22502156 GGCCGGCGTGCTCCTCCAGCTGG - Intergenic
1117867480 14:60165030-60165052 GGCCCGGCTGCCCCTTACGCAGG - Intronic
1118896466 14:69949724-69949746 GGCCCGTGTGCCCCACCAGCAGG + Intronic
1120873707 14:89360231-89360253 GGCCCAGCTGCCCCTAAAGGAGG + Intronic
1121342834 14:93115531-93115553 GGCCCGGCTTCCCCTCCTGCGGG - Intronic
1122901626 14:104784493-104784515 GTCCCGGGTGGCCCTCCGGCAGG + Intronic
1122985231 14:105208794-105208816 AGGCCGGGAGCCCCTCCAGCTGG + Intergenic
1123006185 14:105324951-105324973 GGCCCGTGTGCACCCCCAGCAGG - Intronic
1127753576 15:62068451-62068473 GGCCCGGGGGCGCCTCCGGCCGG - Exonic
1129714257 15:77837835-77837857 GGCCTGGGTGCGCATGCAGCAGG + Intergenic
1131153908 15:90063245-90063267 GGCCCGTGTGGCCCCACAGCTGG - Intronic
1136672903 16:31874032-31874054 GGCCCGGGTGCCCCTACAGCGGG - Intronic
1138553713 16:57760450-57760472 GACCCTGTTGCCCCTCCAGCTGG - Intronic
1141615631 16:85207965-85207987 GGCCCGGGTGACCTCACAGGAGG + Intergenic
1141979904 16:87543617-87543639 GGGCCGAGGGCCCCTGCAGCTGG + Intergenic
1142187129 16:88699848-88699870 GGACCGGGTCCCCCTGCTGCTGG - Intronic
1142219637 16:88847597-88847619 GGCCCTGGTGCTCCAAGAGCCGG + Intronic
1144620435 17:16815299-16815321 GGCCCTCGTCCCCCTACATCTGG + Intergenic
1157136775 18:45063779-45063801 GGCGTGGGTGTCCCTGCAGCGGG - Exonic
1160956984 19:1698402-1698424 GGCCCAGGTGCCTCTGCAGTGGG + Intergenic
1162615702 19:11798789-11798811 GGCCTGGGTCCCGCCACAGCAGG - Intronic
1162617576 19:11814509-11814531 GGCCCGGGTCCCGCCTCAGCCGG - Intronic
1162630765 19:11925334-11925356 GGCCCGGGTCCCGCCACAGCCGG - Intronic
1162635636 19:11965272-11965294 GGCCCGGGTCCCGCCGCAGCCGG - Intronic
1162643985 19:12035455-12035477 GGCCCGGGTCCCACCACAGCCGG + Intronic
1162646301 19:12052714-12052736 GGCCCGGGCCCCGCCACAGCGGG + Intronic
1162651553 19:12092533-12092555 GGCCCGGGTCCCGCCACAGCCGG - Intronic
1162664091 19:12195204-12195226 GCCCCGGGTCCCGCCACAGCCGG - Intergenic
1162668742 19:12237388-12237410 GGCCCGGGTCCCACCACAGCAGG + Intronic
1162672110 19:12266200-12266222 GGCCCGGGTCCCGCCACAGCCGG + Intronic
1162675376 19:12294608-12294630 GGCCCGGGTCCCGCCACAGCCGG + Intronic
1162683801 19:12365449-12365471 CGCCCGGGTCCCGCCACAGCCGG + Intronic
1162698440 19:12495610-12495632 GGCCCGGTTCCCGCGACAGCCGG - Intronic
1162700852 19:12513658-12513680 GGCCCGGGTCCCTCCACAGCTGG + Intronic
1162705368 19:12551246-12551268 GGCCAGGGTGCTTCCACAGCCGG + Intronic
1162759604 19:12880953-12880975 GGCCCGGGGCCCCCTTCACCTGG + Exonic
1163366226 19:16877501-16877523 GCCCGTGATGCCCCTACAGCAGG - Intronic
1163369899 19:16896249-16896271 GGCCCCGGGGCCTTTACAGCAGG - Exonic
1163807067 19:19405878-19405900 GGCCCGGGCGGCCCCACAGGCGG + Intronic
1165370517 19:35402729-35402751 TGCCCAGGTGCCCATACAGCTGG + Intergenic
1166852773 19:45768433-45768455 GGCCCTGGTGGCCTTCCAGCGGG - Exonic
1167513558 19:49909764-49909786 GGCACTGGGGCCCCTACAGGCGG - Exonic
1167589911 19:50398881-50398903 GCCCGGGGTGCCCCCAAAGCGGG + Exonic
925858987 2:8156905-8156927 GGCCCAGGTTCCCCTACACTGGG - Intergenic
925923391 2:8653209-8653231 GGCCCGGCTGCCCTGACTGCTGG - Intergenic
927888328 2:26731961-26731983 AGCCAGGGGGCCCCTACTGCAGG - Exonic
928738714 2:34323994-34324016 GGCCCAGGAACCCCTAAAGCAGG - Intergenic
934709938 2:96508260-96508282 GGCCCGGGAGCCCCCAAAGCCGG + Intergenic
937120571 2:119437602-119437624 GGCCCGGGGGCCTCTGCACCTGG + Exonic
937449867 2:121993070-121993092 GGCTCTGTGGCCCCTACAGCTGG - Intergenic
948361233 2:237422000-237422022 GGCCCGGGGAGACCTACAGCAGG + Intronic
948764795 2:240213753-240213775 AGCCCAGGTGCCCCTGCTGCAGG - Intergenic
1170889952 20:20368368-20368390 GGCGCGGGCGCCCCCGCAGCTGG - Exonic
1173871363 20:46344077-46344099 GGCCCTGGGCCCCCTACAGTGGG + Intergenic
1174545382 20:51321399-51321421 GGCCTGGGTGCCTCTACTTCTGG - Intergenic
1176149583 20:63583070-63583092 GGCCAGGGAGCCCCTCCTGCTGG + Intergenic
1179044398 21:37831736-37831758 GGACCGTGTGCCCCTCCTGCAGG - Intronic
1179681068 21:43021815-43021837 GGGCCGGGTGCACCCACAGGTGG + Intronic
1180593883 22:16961553-16961575 GTCCCAGATGCCCCTCCAGCTGG + Intergenic
1180969402 22:19807268-19807290 GGCCAGGGCCCCCCTACACCTGG + Intronic
1182062874 22:27410466-27410488 GGCCGGTGTGCACCTAGAGCAGG + Intergenic
1183086587 22:35490731-35490753 GGCCCTGTTGCCCCCACACCAGG + Intergenic
1183186107 22:36292471-36292493 GGGCTGGGAGCCCCCACAGCGGG - Intronic
1183188096 22:36304000-36304022 GGCCAGGTAGCCCCTGCAGCAGG + Exonic
949970214 3:9397570-9397592 GTCCCGGGTGCCCCTGGCGCCGG + Intergenic
951718627 3:25674631-25674653 GTCCCGGCTGCGCCTTCAGCCGG + Intergenic
953023953 3:39134244-39134266 GGTCCAGGTGCCCCTGGAGCAGG - Exonic
953055494 3:39384112-39384134 TGCCCGGGTGCCCTTCCACCTGG - Intronic
953885882 3:46714139-46714161 GGCCAGGGTGCCACCACAGATGG - Intronic
954278846 3:49561178-49561200 GGCCTGGTTGCCCCTAAAGTGGG + Intronic
954404459 3:50337693-50337715 GGCCCGGGTCCGCTTGCAGCGGG + Intronic
956322089 3:68008130-68008152 GGCGCTGGTGCCCCTGCAGGTGG + Intronic
956619387 3:71205658-71205680 AGGAGGGGTGCCCCTACAGCTGG - Intronic
961200850 3:125043958-125043980 GGCCCCGGTGTCCACACAGCTGG + Intronic
961501337 3:127338096-127338118 GGCTCCGGGGCCCCTCCAGCGGG - Intergenic
968506246 4:972688-972710 GGCCCGGGTGCTCCCAGGGCTGG - Intronic
969302142 4:6303438-6303460 GCCCCAGGGGCCCCTCCAGCTGG - Intergenic
969433925 4:7173111-7173133 GGCCCAGATGCCCCTGCCGCAGG - Intergenic
969663701 4:8544996-8545018 GACCCTGGTGCCCCCACTGCCGG - Intergenic
974549278 4:63349812-63349834 GGCCCGGGGGCCCTTTCAGCAGG + Intergenic
980053925 4:128061977-128061999 GGCCCGGGGGCCCTTTCGGCGGG + Intronic
985529979 5:428445-428467 GGCACAGCTGCCCCTCCAGCTGG + Intronic
985721063 5:1489318-1489340 AGCCAGGCTGCCCCTACAGCTGG + Intronic
988591752 5:32555626-32555648 GGCCCAGGTTTGCCTACAGCAGG - Intronic
992399939 5:76403111-76403133 GGGCCGGGACCCCCTGCAGCTGG - Intergenic
997469153 5:134107162-134107184 GGCCCGGTTGAGCCTACTGCAGG - Intergenic
1002598038 5:180336846-180336868 GGCCTGGGAGCGCCTGCAGCGGG - Intronic
1017051218 6:150395560-150395582 TGCCCAGGTGCCTCTGCAGCAGG + Exonic
1019126901 6:169846559-169846581 GGCCCGTGTGCTCCTGCACCTGG - Intergenic
1019510231 7:1414069-1414091 GGCCCGGGTGTCAACACAGCAGG + Intergenic
1019515923 7:1440138-1440160 GGCCTGGGAGCCCCTCCAGGTGG - Intronic
1020849789 7:13337782-13337804 AGCCAGGATCCCCCTACAGCTGG - Intergenic
1029283918 7:99453371-99453393 GGCACGGCTGCACCTACACCTGG - Intronic
1032202761 7:129834458-129834480 GGCTCCGATGCCCCCACAGCAGG + Exonic
1034174645 7:149090910-149090932 GGCCCGGGCGCCCTCAGAGCAGG + Intergenic
1035221874 7:157411017-157411039 GGCACGGCAGCCCCTCCAGCCGG + Intronic
1035459253 7:159029246-159029268 GGCCCAGGTGCCCCGACTGTGGG - Exonic
1035812949 8:2507665-2507687 GGCCCGGGTCCCCCTAGGGCAGG + Intergenic
1047202829 8:122781189-122781211 GGCCCGGGTACCGCCAGAGCCGG + Intergenic
1049000963 8:139825449-139825471 GGCCCTGGTGCCCATCCATCCGG - Intronic
1049271507 8:141698603-141698625 GGCCCAGATGCCTCTGCAGCCGG - Intergenic
1052647388 9:31254106-31254128 GGCCAGGTTGCCCCTCCAGAAGG - Intergenic
1057293870 9:93824386-93824408 GCCCCTGGTGCCCCCACACCCGG + Intergenic
1061204019 9:129152698-129152720 GACCCCGGTGTCCCTACGGCAGG - Intergenic
1061878011 9:133554566-133554588 GGCCCGGGTGGCCGAACAGCCGG - Exonic
1061883327 9:133578768-133578790 GGACCAGGTGACCATACAGCCGG - Exonic
1062037748 9:134390233-134390255 GGCCCGGGTGCCCCTAGAAGTGG + Intronic
1062270149 9:135704576-135704598 GGCCCTGGTGGCCCCAGAGCTGG + Intronic
1062277245 9:135736782-135736804 GGCCCGCGCGCCCCTACCTCTGG - Intronic
1062421540 9:136484713-136484735 GGCCCTGGTGCCACGTCAGCCGG - Exonic
1062462909 9:136669305-136669327 GGCCTGGATGCCCCCACAGTAGG + Intronic
1062639977 9:137514165-137514187 GGCCCGGGCACCTCAACAGCCGG - Intronic
1062640114 9:137514595-137514617 GGCCCGGGCACCTCAACAGCCGG - Intronic
1198310183 X:135422395-135422417 GACACGGGCGCCCCTTCAGCCGG - Intergenic
1201555971 Y:15264947-15264969 GGCCCAGGTTTCCCTACAGCAGG + Intergenic