ID: 1136673292

View in Genome Browser
Species Human (GRCh38)
Location 16:31876892-31876914
Sequence CAGCCTGCTCACCCCATCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 5, 2: 14, 3: 31, 4: 288}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136673287_1136673292 -8 Left 1136673287 16:31876877-31876899 CCCCTGCAGGTTTCCCAGCCTGC 0: 1
1: 4
2: 10
3: 53
4: 429
Right 1136673292 16:31876892-31876914 CAGCCTGCTCACCCCATCCATGG 0: 1
1: 5
2: 14
3: 31
4: 288
1136673286_1136673292 4 Left 1136673286 16:31876865-31876887 CCAGGGGAGTTTCCCCTGCAGGT 0: 1
1: 0
2: 3
3: 17
4: 173
Right 1136673292 16:31876892-31876914 CAGCCTGCTCACCCCATCCATGG 0: 1
1: 5
2: 14
3: 31
4: 288
1136673284_1136673292 17 Left 1136673284 16:31876852-31876874 CCAGTTAGTTCTTCCAGGGGAGT 0: 1
1: 0
2: 4
3: 13
4: 105
Right 1136673292 16:31876892-31876914 CAGCCTGCTCACCCCATCCATGG 0: 1
1: 5
2: 14
3: 31
4: 288
1136673288_1136673292 -9 Left 1136673288 16:31876878-31876900 CCCTGCAGGTTTCCCAGCCTGCT 0: 1
1: 1
2: 17
3: 105
4: 468
Right 1136673292 16:31876892-31876914 CAGCCTGCTCACCCCATCCATGG 0: 1
1: 5
2: 14
3: 31
4: 288
1136673283_1136673292 18 Left 1136673283 16:31876851-31876873 CCCAGTTAGTTCTTCCAGGGGAG 0: 1
1: 2
2: 5
3: 19
4: 143
Right 1136673292 16:31876892-31876914 CAGCCTGCTCACCCCATCCATGG 0: 1
1: 5
2: 14
3: 31
4: 288
1136673289_1136673292 -10 Left 1136673289 16:31876879-31876901 CCTGCAGGTTTCCCAGCCTGCTC 0: 1
1: 1
2: 18
3: 52
4: 339
Right 1136673292 16:31876892-31876914 CAGCCTGCTCACCCCATCCATGG 0: 1
1: 5
2: 14
3: 31
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136673292 Original CRISPR CAGCCTGCTCACCCCATCCA TGG Intronic
900186010 1:1333588-1333610 CAGCCGGCTCGCCCCATGCCAGG - Exonic
900415577 1:2533018-2533040 CTCCCGGCTCACACCATCCACGG + Intergenic
900420885 1:2555489-2555511 CAGCCAGGTGACCCCCTCCAGGG - Intergenic
901489374 1:9588929-9588951 CAGCGCGCTCACTCCCTCCATGG - Exonic
901671126 1:10856905-10856927 CCCCCTGCTCACCCCCTCCTGGG + Intergenic
901688217 1:10956352-10956374 CAGCCTGGTCAGACCCTCCAGGG - Intronic
902112570 1:14094980-14095002 TAGGATGCTCACCCCATTCAAGG + Intergenic
902216890 1:14939964-14939986 TAGCCTGATCATCCCACCCAGGG + Intronic
902503041 1:16923087-16923109 CAGCCAGCTCACACCTTCCCCGG - Intronic
904367576 1:30024557-30024579 CAGTCTTCACACCCCAACCATGG - Intergenic
904466085 1:30708254-30708276 AGGCCTGCTCACCCCATTCCTGG + Intergenic
904566017 1:31428899-31428921 CAGCCCACTCACACCAGCCAAGG - Intronic
905205640 1:36341421-36341443 GAGCCTGCTCACCCCACTCCAGG - Exonic
905404140 1:37721887-37721909 CAGCCTGCCCAGCTCAGCCAGGG - Intronic
905775123 1:40663458-40663480 CAGCCTGCTCCCCCCTCCCCAGG + Intronic
906705022 1:47888427-47888449 CAGGCTGTTCACCCCATACAAGG + Intronic
907429684 1:54405060-54405082 CAGCTAGCTCACCCCAAACAGGG + Intronic
908108314 1:60869151-60869173 CAGCCCCCTCACCCCATGCTAGG + Intronic
912509681 1:110180432-110180454 CAGCCAGCTCAGCTCAACCATGG - Intronic
912649506 1:111425334-111425356 CAGCCTGCTCCACCCTCCCAGGG + Intronic
912777216 1:112513395-112513417 CAGCCCTCTCACCCCTTCCCCGG + Intronic
912947804 1:114099104-114099126 CAGCCTGCTCATCTCAGTCATGG - Exonic
913325114 1:117621341-117621363 CTTCCTGTTCACCCCAACCAGGG + Intronic
913711434 1:121487891-121487913 CAGCCTGCACATCTCACCCATGG + Intergenic
915980520 1:160417106-160417128 CATACTGCCCACCCCCTCCAAGG - Intronic
918695960 1:187546597-187546619 CAGTCTTCACACCACATCCAGGG + Intergenic
919585441 1:199432795-199432817 CAGTCAGCTCACCACGTCCATGG - Intergenic
919880613 1:201898282-201898304 GACCCTGCCCACCCCATCCCTGG - Exonic
920051379 1:203166923-203166945 CAGCCTGCTAAACCCACCCCAGG - Exonic
920438118 1:205961292-205961314 CTGCTTCTTCACCCCATCCAGGG - Intergenic
922456369 1:225776914-225776936 CCTCCTCCTCACCCCATCAAAGG + Intergenic
924019813 1:239769190-239769212 CTACCTGTTCACCCCATCCTGGG - Intronic
1063158116 10:3398303-3398325 CAGCCTGCTCACCTGCACCATGG - Intergenic
1064018276 10:11789587-11789609 CATCCTGCTCACATCATCCAAGG - Intergenic
1064033594 10:11898680-11898702 CCTCCTGGTCACCCCATCCCAGG - Intergenic
1064262024 10:13793617-13793639 CAGCCTCCCCACTCCAGCCATGG - Intronic
1066975392 10:42363596-42363618 CAGCCCGCTCACCCCAGCCATGG - Intergenic
1067469674 10:46527498-46527520 CTGCCTTCTCCCCCCATCGAGGG - Intergenic
1067543949 10:47178423-47178445 CAGGCTGCACATCCCTTCCAAGG + Intergenic
1069570315 10:69490905-69490927 CAGCCGGCCCTCCACATCCACGG - Intronic
1071315573 10:84392750-84392772 CAGCCTGCACACCCCAAAAAAGG - Intronic
1072211227 10:93248807-93248829 CCGCCTGCTCAGCCCATGCATGG - Intergenic
1072417899 10:95264113-95264135 CAGCCTGCACTGCCCATCAAGGG - Intronic
1074363797 10:112842289-112842311 CACCCTGCTTCCCCCATCCTGGG + Intergenic
1074424073 10:113335761-113335783 CACCCTGGTCTCCCCAGCCAAGG - Intergenic
1076300418 10:129421501-129421523 CAGCCTGCCCCCTCCAGCCATGG + Intergenic
1077506271 11:2931271-2931293 CAGCCTGCCTACCCCATTGAGGG + Intergenic
1077555887 11:3225854-3225876 GAGCCTGCTCTCAGCATCCAGGG - Intergenic
1077574996 11:3376198-3376220 CAGACTGCTCACAGCAACCATGG - Intronic
1078333951 11:10449917-10449939 CAGCCCGCTCTCCCACTCCAAGG - Intronic
1078339878 11:10491110-10491132 CCGCCTCCTCACCCCAGCCCGGG + Intronic
1079097157 11:17518370-17518392 CAACCTTCTCTCCCTATCCAAGG - Intronic
1079133765 11:17764596-17764618 CACTCTGCTCACACCCTCCACGG + Intronic
1079336858 11:19577662-19577684 TAGGCTGCTCACCCCATGCCAGG - Intronic
1081833821 11:46137039-46137061 CAGCCTGCTCGCCCCAGCCTCGG + Intergenic
1083652378 11:64210988-64211010 CAGCCTCCCCACCTCACCCATGG - Intronic
1085455222 11:76661650-76661672 CAGCCTGATCACCCCATGCCTGG + Intronic
1087992545 11:104763285-104763307 CATCCTGCTCATCCAATACATGG - Intergenic
1088469278 11:110176485-110176507 CCTCCTGCTCCCCCCAGCCACGG + Intronic
1090652419 11:128819256-128819278 CACCCTCCTCACCCCACCCCAGG + Intergenic
1093138619 12:15480502-15480524 CAGCCTGACCTCCCCATGCATGG + Intronic
1096038268 12:48492062-48492084 AAGGCTCCTCACCCCTTCCATGG - Intronic
1096806490 12:54144158-54144180 CAGCCTCTTCACCTCATCCTGGG - Intergenic
1096916769 12:55041389-55041411 CAGCCTTCACACCCCAATCAAGG - Intergenic
1097056508 12:56253220-56253242 CAGACTGCTCACATCAACCATGG - Intronic
1102469660 12:113152653-113152675 CTCCCTGCTCAACCCATCCGGGG - Intronic
1103703153 12:122858376-122858398 CAGGGTGCTCACGGCATCCAAGG - Exonic
1105625231 13:22106330-22106352 CACCCTGCTCTCCCCTACCAGGG - Intergenic
1106132499 13:26951870-26951892 CAGCCTGCTAATTCCAACCAAGG + Intergenic
1106222173 13:27755328-27755350 CAGGCTGCTGACACCATCAAAGG - Intergenic
1106224820 13:27777078-27777100 TTGCCTGTTCACCCCATCCCAGG - Intergenic
1106670131 13:31896480-31896502 GAGCCTCCTCAGCCCCTCCACGG - Intergenic
1111909763 13:94297806-94297828 CAGAGTGCTGAACCCATCCAGGG + Intronic
1112997809 13:105595976-105595998 CAGCCTGCTCAGCCCAACTGTGG + Intergenic
1113200911 13:107867055-107867077 CAGCCCGCTCTCCCCTGCCAGGG + Intergenic
1113574589 13:111385686-111385708 CATCCTGCAAACCCCAGCCAGGG + Intergenic
1113670352 13:112171660-112171682 CCACCAGCTCACCCCATCCCAGG - Intergenic
1114526981 14:23372514-23372536 ATCCCTGCTCCCCCCATCCAGGG - Intergenic
1120865249 14:89290899-89290921 CATCCTCCTCACCTCCTCCAGGG - Intronic
1121008208 14:90503852-90503874 CTGCCTGCTCACCTCCCCCAAGG - Intergenic
1122297513 14:100713714-100713736 GAGCCTGCTGACCCCTCCCAGGG + Intergenic
1122327882 14:100893385-100893407 CTGCCTGCCCACCCGATCCCTGG + Intergenic
1122449800 14:101796636-101796658 CAGCCAGCCCAGCCCCTCCAGGG + Intronic
1122596391 14:102895908-102895930 CAGCCTGCTCACCCTCAACACGG - Intronic
1122906570 14:104804313-104804335 CAGGCTGCCCACCCCAGCAAAGG - Exonic
1123042477 14:105496062-105496084 CAGCCTGCTCTCCCCTTTTAGGG + Intronic
1123538324 15:21261583-21261605 CAGCCAGCCCTCCCCACCCAAGG + Intergenic
1123695359 15:22875174-22875196 GAGCCTGCTGACCCCCACCAGGG - Intronic
1123702771 15:22928070-22928092 CACCCAGCTCCCCCCATCCCGGG + Intronic
1124104898 15:26728557-26728579 TGGCCTGCTCACCATATCCATGG - Intronic
1126695326 15:51321089-51321111 CAGCCTGCTTACTTCATCCAGGG + Intronic
1129117936 15:73375636-73375658 CAGGGTGCTCACCCACTCCAGGG - Intergenic
1129249891 15:74303011-74303033 CAGGCTGCAGACCCCATCCTGGG - Intronic
1129267883 15:74403742-74403764 CTTCCGGCTCACCCCTTCCATGG + Intergenic
1130159825 15:81387702-81387724 CAGGCTGCTTCTCCCATCCATGG - Intergenic
1130573925 15:85073879-85073901 CTGCCTGCTCTCCCCAGTCAGGG + Intronic
1131013449 15:89038535-89038557 CAGCCTGCTGACCTCAGCCAGGG - Intergenic
1133054250 16:3137607-3137629 CAGCCTCCTCACCGCTTCCCGGG - Exonic
1136673292 16:31876892-31876914 CAGCCTGCTCACCCCATCCATGG + Intronic
1137601212 16:49757656-49757678 CGGGCTCCTCACCCCACCCAAGG - Intronic
1138376666 16:56568941-56568963 CATCGTGCCCACCCCTTCCAAGG + Exonic
1139513881 16:67442225-67442247 CAGCCAGCTCGCTCCAACCAGGG + Intronic
1140055947 16:71525907-71525929 CTGCCTGCTCACTCCACCCTGGG - Intronic
1141553428 16:84821169-84821191 GAGCCTGCTTTCCCCATCCAGGG + Intronic
1141604946 16:85147328-85147350 CAGCCTGCTCACCTGCCCCATGG + Intergenic
1141646278 16:85369749-85369771 CAGCCAGCTCAGCCCAGCCAGGG - Intergenic
1141886031 16:86893006-86893028 CAGCCTCCTGTCCCCCTCCAGGG + Intergenic
1142242605 16:88954422-88954444 AAGGCTCCTGACCCCATCCAAGG + Intronic
1142242749 16:88954916-88954938 AAGGCTCCTGACCCCATCCAAGG + Intronic
1142242851 16:88955258-88955280 AAGGCTCCTGACCCCATCCAAGG + Intronic
1143382770 17:6506885-6506907 AGGCCTGCTGGCCCCATCCAGGG + Intronic
1143530316 17:7499170-7499192 CAGCCTGCTTCCCTCAGCCAGGG - Intronic
1144638353 17:16924775-16924797 CAGGCTGTTCACCCCATGCCAGG + Intergenic
1145193358 17:20866995-20867017 CAGCCAGCGCTCCCCACCCAAGG + Intronic
1145298663 17:21614086-21614108 CAGCCAGCCCTCCCCACCCAAGG - Intergenic
1145723151 17:27090822-27090844 CAGCCAGCCCTCCCCACCCAAGG - Intergenic
1147443463 17:40461274-40461296 AAGTCTGCCCTCCCCATCCAGGG - Intergenic
1148221362 17:45864773-45864795 CAGCCTGGCCACACCTTCCACGG + Intergenic
1150681685 17:67289799-67289821 CAGCCTGCTGCTCCCTTCCAGGG - Intergenic
1151896062 17:76981735-76981757 CAGCCTGCCCACCCCTGCCATGG + Intergenic
1152130616 17:78474092-78474114 CAGCCTGCACTGCCCCTCCAGGG + Intronic
1152335637 17:79699062-79699084 CACCCTGCTGACCACACCCACGG + Intergenic
1152425899 17:80218524-80218546 CAGCCTCCTCTGTCCATCCATGG - Intronic
1153739836 18:8112389-8112411 CTGCCTGCTATCCCCACCCATGG - Intronic
1155555630 18:27016052-27016074 GACCCTGCTCATCCCAGCCATGG + Intronic
1157688782 18:49664231-49664253 CAGCCTGGGGACTCCATCCAAGG + Intergenic
1158901477 18:61965982-61966004 CAACCTCCACACCCCATCCCTGG + Intergenic
1160055455 18:75474988-75475010 CATCCAGTTGACCCCATCCAGGG - Intergenic
1160972609 19:1776161-1776183 CACCCTTCCCACCCCATCCCAGG + Exonic
1161580612 19:5078667-5078689 CTGCCTGCCCACCCCTTCGATGG - Intronic
1161797631 19:6396374-6396396 CAGCCCGGGCCCCCCATCCAGGG - Intergenic
1162704826 19:12547650-12547672 CAGCCTTATCACTCCAACCAGGG - Intronic
1163618693 19:18344678-18344700 CTGCCTGCTCACCCGCTCCCCGG + Intronic
1163884536 19:19954162-19954184 CAGCCTGCTCACCCCAGCCATGG - Intergenic
1163908672 19:20169469-20169491 CAGCCTGCTCACCCCACCCATGG + Intronic
1163915048 19:20233833-20233855 CAGCCTGCTCACCCGAGCCATGG - Intergenic
1163933675 19:20422793-20422815 CAGCCTGCTCACCCCAGCTATGG - Intergenic
1163957729 19:20659903-20659925 AAGACTGCTCACCCCAGCCACGG - Intronic
1163983839 19:20926648-20926670 CAGCCTGCTCACCCCAGCCATGG + Intronic
1163999662 19:21085694-21085716 CAGTCTGCTCACCCCAGCCATGG + Intronic
1164005585 19:21145546-21145568 CAGTCTGCTCAACCCAGCCATGG + Intronic
1164027175 19:21363409-21363431 TAGCCTGCTCACTCCAGTCATGG + Intronic
1164030644 19:21400644-21400666 CAGCCTGCTCACTCCAGCCATGG + Intronic
1164042917 19:21509599-21509621 CTGCCTGCTCACCCCAGCCATGG + Intronic
1164070537 19:21764093-21764115 CAGCCTTCTCACTGCAGCCATGG - Intronic
1164095529 19:22006596-22006618 CAGCCTGCTTACCGCAGCCATGG - Intronic
1164114998 19:22211281-22211303 CAGCCTGCTTACCGCAGCCATGG - Intergenic
1164123617 19:22290194-22290216 CAGCCTGCTCACCCCAGCCATGG + Intronic
1164176518 19:22780077-22780099 CAGCCTGCTCACCCCAGTCATGG - Intronic
1164183020 19:22836184-22836206 CAGCCTGCTCACCCTAGCCATGG + Intergenic
1164198806 19:22999446-22999468 CAGCCTGCTTACCCCAGCCATGG - Intronic
1164225934 19:23245978-23246000 TAGCCTGCTCACTCCAGCCATGG - Intronic
1164241302 19:23391758-23391780 CAGCTTGCTCACCTCAGCTATGG - Intronic
1164272147 19:23682583-23682605 CAGCCTGCTCACCCCAGCCATGG - Intronic
1164309621 19:24034287-24034309 CAGCCTGCTCACAATAGCCATGG + Intronic
1165200795 19:34142784-34142806 CAACCTGCTCAACCCCACCATGG + Intergenic
1165477382 19:36039287-36039309 CAGCCTGGCAGCCCCATCCATGG - Intronic
1167669409 19:50841228-50841250 CACCCTCCTCCACCCATCCAGGG - Intergenic
1167697799 19:51025355-51025377 CAGCTTCCTCAGCCCCTCCACGG + Intronic
1167781751 19:51602840-51602862 CTGCCTGCTCAAACCCTCCAGGG + Intergenic
925085199 2:1102309-1102331 CAGCCTCCTCACAACAGCCAGGG - Intronic
925100035 2:1236434-1236456 CTGCCTGCCCTCCCCATGCAGGG + Intronic
927808850 2:26171002-26171024 CAGCCCGCTCACCCTGGCCAGGG - Intergenic
928091093 2:28375575-28375597 CAGGCTGCCAACCCCATCAAGGG - Intergenic
930675626 2:54197573-54197595 CATCCTGGCCACCCCATCTAAGG - Intronic
931250802 2:60529155-60529177 CAACCTGCTCACCCCATAATGGG + Intronic
931542248 2:63342011-63342033 CCCCCTCCCCACCCCATCCATGG - Intronic
932012792 2:67994801-67994823 TGGCATGCCCACCCCATCCAGGG + Intergenic
932707492 2:74038009-74038031 CACCCTGCTCTCCCCACCCAGGG - Intronic
934647175 2:96065737-96065759 GAGCCTGCTCATCCCACCCTGGG - Intergenic
936146020 2:109981127-109981149 AGGCCTCCTCACCACATCCAGGG + Intergenic
936198669 2:110390351-110390373 AGGCCTCCTCACCACATCCAGGG - Intergenic
936506879 2:113115269-113115291 CAGTCTTCTCACGGCATCCAGGG + Intronic
937594126 2:123652357-123652379 CAGCCTGCTGAGCCTAGCCAGGG - Intergenic
937908017 2:127061811-127061833 CAGGCTGCCCACCCCAACCCTGG + Intronic
937913962 2:127089917-127089939 CCCCCTGCTCCCCCCACCCAGGG + Intronic
938101554 2:128501166-128501188 GAGCCTCCTCACCCACTCCAGGG - Intergenic
940724838 2:157325420-157325442 CATGCTGCTCAACTCATCCATGG - Exonic
942198859 2:173550961-173550983 CAGCTTGCACTCCCCATCCTTGG - Intergenic
945884878 2:215364448-215364470 CAGCCGGTTCTCCCCATCCTGGG - Intronic
946165791 2:217863035-217863057 CTCCCTGGTCACCCCCTCCAAGG + Intronic
946339148 2:219057253-219057275 CTGCCTGCTCATCCCATGCCTGG - Intronic
946396847 2:219447694-219447716 CAGCCTCCTCCCCCCAGCCCTGG - Intronic
947812106 2:233011077-233011099 CAGCCCTCTCACCCCAACAACGG - Intronic
947900497 2:233717616-233717638 GAGCCTGCCCACCTCATCCTGGG + Intronic
947926345 2:233925625-233925647 CTTCCTCCTCACCCCTTCCAAGG - Intronic
948597322 2:239088342-239088364 CGTCCGGCTCACCCCGTCCATGG - Intronic
948934960 2:241157869-241157891 CCGCCTGCTCAGCCCAGCCTTGG + Intronic
949012716 2:241690489-241690511 CAGCCTGCTGACCTCAGCCCTGG + Intergenic
1168956959 20:1841156-1841178 CATCCTGCTCCCCCGACCCAAGG + Intergenic
1169900878 20:10550631-10550653 CAGCCTCCTCAGCCTGTCCAGGG + Intronic
1169933014 20:10854021-10854043 CAGCCTGGGCTCCCCATCCAGGG - Intergenic
1171561916 20:26134489-26134511 CAGCCAGCCCTCCCCACCCAAGG + Intergenic
1172972595 20:38884209-38884231 CAGCCTGCTCAGCCACGCCAGGG - Intronic
1173005133 20:39134398-39134420 TTCCCTGATCACCCCATCCAAGG - Intergenic
1176001214 20:62832133-62832155 GAGCCTTCTCTCCACATCCAGGG + Exonic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1176869687 21:14074982-14075004 CATCCGCCTCTCCCCATCCAAGG + Intergenic
1177240679 21:18452588-18452610 CAGCCTCAACATCCCATCCAGGG - Intronic
1178166707 21:29986000-29986022 CAGCATGCCCACTCCAGCCATGG + Intergenic
1179397305 21:41053020-41053042 CAGCGTCCTCGCCCCATCCAGGG - Intergenic
1179470278 21:41605665-41605687 CAGCCTGCTCTGCTCACCCACGG - Intergenic
1179995731 21:44973314-44973336 CACCCTGCCCACCCTCTCCAGGG + Intronic
1180825627 22:18858945-18858967 CAGGCTGCTCACCCCAGGCCTGG - Intronic
1180952680 22:19727769-19727791 CAGCGTACTCACCGCGTCCACGG - Intergenic
1180971243 22:19816918-19816940 CCCCCTTCCCACCCCATCCAAGG + Intronic
1181746058 22:24955653-24955675 CAGCCTCCCCACACCAGCCAGGG - Intronic
1182036000 22:27198798-27198820 GAGCCTGCTCTACCCATGCATGG - Intergenic
1182622186 22:31624213-31624235 CACCCTGCTCTCCCCTTCCTGGG - Intronic
1182830371 22:33300153-33300175 CAGCCTGCTCACTCTGTCGAAGG - Intronic
1183090780 22:35520368-35520390 CAGCCTGCTGACACCTTCCTTGG - Intergenic
1183167555 22:36159259-36159281 CAGGCTGCTGACCCCATCTGGGG - Intronic
1183533859 22:38383277-38383299 CAGCCTGCTAATCCCATTAAGGG + Intronic
1183744650 22:39685654-39685676 CAGCAGGCAGACCCCATCCAAGG - Intronic
1184388680 22:44190731-44190753 CAGCCAGCTCCACCCATGCAGGG - Intronic
1184399522 22:44265780-44265802 CAGCTTGCACACCCCAGCGATGG + Intronic
1185128832 22:49026004-49026026 CACCCAGCTGACCCCATCCAGGG - Intergenic
1185244090 22:49764006-49764028 CAGCCTGGGCACCCCACCCAAGG + Intergenic
1185366886 22:50440945-50440967 ACCCCTGCTCACCGCATCCATGG - Exonic
1203214860 22_KI270731v1_random:541-563 CAGGCTGCTCACCCCAGGCCTGG + Intergenic
950527475 3:13532846-13532868 CACCCTCCCCACCCCATCCCTGG - Intergenic
951646593 3:24898833-24898855 CAGGCTGCACACCACATTCAAGG + Intergenic
952154351 3:30626770-30626792 CAGCCTGCTCAGCCCCTGGAAGG - Intronic
952540071 3:34358170-34358192 CAGCTTCCTCACCCCTTACAGGG - Intergenic
953388520 3:42520925-42520947 TAGCCTGGTCACCTCCTCCAGGG + Intronic
953632326 3:44629472-44629494 CAGCCTCCTCGCCACTTCCAGGG - Exonic
954412229 3:50375797-50375819 CTGCCTCCTTACCTCATCCAGGG + Exonic
954671286 3:52292622-52292644 AACCCGCCTCACCCCATCCATGG + Exonic
955514694 3:59715144-59715166 CTCCCTGCTTCCCCCATCCAAGG + Intergenic
960976978 3:123185029-123185051 CATCCCCGTCACCCCATCCATGG - Intronic
961653574 3:128429413-128429435 CAGCCTCCTGCCCCCATCCCGGG + Intergenic
962355040 3:134686430-134686452 CAGCCTGCTGACCCTAGCCCAGG - Intronic
963814342 3:149813007-149813029 CACCCTGCTCTTCCCTTCCAGGG + Exonic
966819655 3:183914760-183914782 CTGTCTGCAGACCCCATCCAGGG + Intergenic
966911494 3:184562485-184562507 CGGCCTCCCCACCCCATCCCTGG - Intronic
968280449 3:197472962-197472984 CACCATGCTCAGCCCATCCAGGG + Intergenic
968656435 4:1780284-1780306 CAGCCTCCTCCCCAAATCCATGG + Intergenic
970721522 4:18995029-18995051 CTGCCTGGCCACCCCAGCCATGG + Intergenic
971863605 4:32140584-32140606 CATCCCCTTCACCCCATCCATGG + Intergenic
974322149 4:60365321-60365343 CAGCCTTCTCAGCCCTTGCAGGG + Intergenic
976053101 4:81031283-81031305 CAGCCTGCTCGCCCCAGCCATGG - Exonic
976674592 4:87690556-87690578 CCACCCCCTCACCCCATCCATGG + Intergenic
979522616 4:121686324-121686346 CAGCCCGCTCATCAAATCCAGGG + Exonic
980207606 4:129741393-129741415 GAGTCTCCTCACCTCATCCATGG + Intergenic
981078858 4:140618317-140618339 CAGCATCCTCACCCCCACCAAGG - Intergenic
982165089 4:152607014-152607036 CTGCCTGCTCACCTCCTGCAGGG + Intergenic
982262363 4:153505877-153505899 CAGCCTCCTCACCACACCCTGGG - Intronic
984850463 4:184147914-184147936 CATGCTTCCCACCCCATCCAGGG + Intronic
985492650 5:188399-188421 CAGGCTGCTCCCACCATCCCTGG + Exonic
995846012 5:116494538-116494560 CAGACTCCTCACCTCATGCATGG + Intronic
1001280326 5:170382013-170382035 CAGCCTCCACGCCCCATCCCAGG + Intronic
1002049401 5:176561559-176561581 CTGCCTCCTCCGCCCATCCATGG - Intronic
1002188274 5:177465992-177466014 CATCATCCCCACCCCATCCAAGG + Intronic
1002874961 6:1202560-1202582 CTCCCTCCTCACCCCAGCCATGG + Intergenic
1003217546 6:4128569-4128591 CAGCCTGCCCTCCGTATCCACGG + Intronic
1003599057 6:7501254-7501276 CAGCATCCCCACCCAATCCAAGG - Intergenic
1003667902 6:8128662-8128684 CAGGATGCTCACCCCATGGAGGG - Intergenic
1006915232 6:37589673-37589695 CAGTCTGATCACCCCAGCTAAGG + Intergenic
1007222932 6:40293402-40293424 CACCCTGCCCACCCCTCCCAAGG - Intergenic
1007351329 6:41275688-41275710 CATCCTGCTCGCCCCATGCTGGG - Exonic
1008434767 6:51462857-51462879 CAGCCAGCTCTACCTATCCATGG - Intergenic
1008575830 6:52859284-52859306 CACACAGCTCTCCCCATCCAAGG - Intronic
1009860513 6:69325012-69325034 CAATATGCTTACCCCATCCAAGG - Exonic
1010283181 6:74043551-74043573 CAGCCTGCTCACCACAGCAGGGG + Intergenic
1010809971 6:80289967-80289989 CTGCCTGCTGGCCCCACCCAGGG + Intronic
1014674707 6:124349284-124349306 CAGCCTGCTCCCCCCTACAAAGG + Intronic
1016369921 6:143362781-143362803 CTGCCTGCTTACCCTACCCACGG + Intergenic
1018784370 6:167096776-167096798 CAGCCTCCGCACTCCATCCTGGG - Intergenic
1019205457 6:170357866-170357888 CAGCCTCTTCACACCATCCTTGG - Intronic
1019316129 7:387787-387809 CAGCCATCTGTCCCCATCCACGG - Intergenic
1019938896 7:4273810-4273832 CAGCCTGGTCCCCCCATCTCTGG + Intergenic
1020096949 7:5374608-5374630 CAGGCTGCCCACCCCGTCCCAGG + Intronic
1020997077 7:15278717-15278739 CAGCCTACTCACTCCCTCCCTGG + Intronic
1021431552 7:20564692-20564714 CAGTCAGCTCACCTTATCCATGG + Intergenic
1024157938 7:46645416-46645438 CACCCTGCTCCTCCCAACCAGGG - Intergenic
1024255716 7:47538515-47538537 CAGACTGCTCCCCACATCCAAGG - Intronic
1024783250 7:52876146-52876168 CAGCCTGTTCACTCCAGACAAGG - Intergenic
1025265624 7:57454528-57454550 CAGCCTGCTCACTCCAGCCATGG + Intronic
1025275950 7:57581204-57581226 CAGCCAGCCCTCCCCACCCAAGG - Intergenic
1025719039 7:63992571-63992593 CAACCTGCTCACCCCAGCCATGG + Intergenic
1025747186 7:64253411-64253433 CAGCCTGCTCACACCAGCAAAGG + Intronic
1025775646 7:64558509-64558531 CAGGCTGCTCACCCCAGCCATGG + Intronic
1025778833 7:64581584-64581606 CAGCTTGCTCACACCAGCCGTGG + Intergenic
1025788968 7:64669993-64670015 TCCCCTGCTCACCCCAGCCATGG + Intronic
1025798551 7:64762341-64762363 CAGCCTACTCACCTCAGCCATGG + Intergenic
1025802271 7:64797574-64797596 GAGCCTGCTCACCCCAGCCATGG + Intronic
1025824935 7:65003122-65003144 CAGCCTGCTCACTCTAGCCATGG - Intronic
1028145716 7:87317990-87318012 CACCCTGCTCACCCCTGCCCAGG - Intergenic
1028609622 7:92695751-92695773 CAGCCTGCCTTCCCCACCCAGGG - Intronic
1029321326 7:99763129-99763151 CAGCCTGCACAGCACACCCAGGG + Intronic
1029331530 7:99860371-99860393 CAGCCTGCCCAGCGCACCCAGGG - Intronic
1029421943 7:100476479-100476501 CTGGCTGCTCACCCCCACCATGG + Intronic
1029616879 7:101664795-101664817 AAGCCTGCACAGCCAATCCAGGG - Intergenic
1029735256 7:102462096-102462118 CAGCCTGCTCAGCCGACACACGG - Intronic
1030037072 7:105416986-105417008 CAGTTTGCTCACCCCATCCGAGG + Intergenic
1031973966 7:128082385-128082407 CAGCCTCCTCAGCCCACCCCAGG + Intronic
1034258329 7:149736766-149736788 CAGGCTGCTCATTCCATCCTGGG + Intergenic
1034553654 7:151836581-151836603 CAGCCTCCACACCCCATCGGAGG - Intronic
1035581929 8:745982-746004 CGGCCTGCTCAGGCCAGCCAAGG + Intergenic
1037873331 8:22521092-22521114 GAGACAGCTCTCCCCATCCATGG - Intronic
1038700353 8:29843759-29843781 CTGCCTGCTCACACCCTACATGG - Intergenic
1039822029 8:41142894-41142916 CACCCTGCTCACCCAGCCCACGG + Intergenic
1040310409 8:46233946-46233968 CAGCCTACCCACGCCATCCTGGG - Intergenic
1040518398 8:48153474-48153496 AAGCCTGCTCTCTCCAACCAAGG + Intergenic
1041830461 8:62147575-62147597 CAGCCTTCTCTCCCCCTCCCTGG - Intergenic
1042798951 8:72696610-72696632 CAGGCTGCTCTCTCCATCCACGG - Intronic
1043406397 8:79938953-79938975 TAGCCAGCTCAGCACATCCAAGG - Intronic
1044720600 8:95142119-95142141 CAACCTGCTCACTACATTCAAGG - Intronic
1047174370 8:122526674-122526696 CCGCATGCACACCCCACCCATGG + Intergenic
1048879036 8:138858169-138858191 CAGCCTTTTCACACCCTCCAAGG + Intronic
1051364588 9:16312473-16312495 CAGCCTGCTTGCCCCACCCTGGG + Intergenic
1053480951 9:38415848-38415870 CAGACTGCCCTCCCCATCCCAGG + Intronic
1054847807 9:69815511-69815533 CAGCCTGCTCACCACATGGTTGG + Intergenic
1056587441 9:87937935-87937957 CAGCCAGCCCTCCCCACCCAAGG + Intergenic
1056609435 9:88115007-88115029 CAGCCAGCCCTCCCCACCCAAGG - Intergenic
1056931069 9:90877837-90877859 CAGGCTGCTCGGCCCATCCAGGG - Intronic
1057353364 9:94317898-94317920 CAGCCAGCTCTCTCCATCCCAGG + Intergenic
1057654387 9:96939694-96939716 CAGCCAGCTCTCTCCATCCCAGG - Intronic
1058164520 9:101605024-101605046 CAGCCTGGGCTCCCCATCCCTGG - Intronic
1058386408 9:104441590-104441612 CATCCATCTCACTCCATCCAGGG - Intergenic
1058880975 9:109285767-109285789 CAGCCTGGACACCCCACCCGGGG + Intronic
1059342910 9:113609619-113609641 CAGCCTGTTCTCCCAATCCTTGG + Intergenic
1059923170 9:119180018-119180040 CAGCCTGGGCTCCCCAGCCAGGG - Intronic
1060661907 9:125409372-125409394 CAGGCAGCTCGCCCCCTCCAGGG - Intergenic
1060945270 9:127566757-127566779 CACCCTCCTCACCCCACCCAAGG - Intronic
1061249812 9:129420204-129420226 CATTCTGCTCCCCCCATCCAAGG - Intergenic
1061805830 9:133137460-133137482 CAGCCTCATCACCTCTTCCAAGG - Intronic
1189725907 X:43968169-43968191 CAGATTGCAAACCCCATCCAGGG + Intronic
1191255933 X:58279646-58279668 CAGCCCCCGCACCCCACCCAGGG - Intergenic
1191842767 X:65524867-65524889 CAGCCTTCACACCCCAACCCAGG + Intronic
1192756382 X:74050198-74050220 CAGGCTGCACACCACAGCCACGG - Intergenic
1195937928 X:110143017-110143039 CAGGCTGCTCTCCCCAACCAAGG - Intronic
1200403719 Y:2787019-2787041 CAGCCAGCTCACCGCAGCAACGG - Exonic
1201900878 Y:19045391-19045413 CACCCAACTCCCCCCATCCATGG - Intergenic
1202593586 Y:26512730-26512752 CAGCCTGCTAATCCCATTAAGGG - Intergenic