ID: 1136677318

View in Genome Browser
Species Human (GRCh38)
Location 16:31922465-31922487
Sequence GCCATTGTGTGAGGAGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136677314_1136677318 14 Left 1136677314 16:31922428-31922450 CCTGTAGAATCTTTTATATCTTG No data
Right 1136677318 16:31922465-31922487 GCCATTGTGTGAGGAGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136677318 Original CRISPR GCCATTGTGTGAGGAGCTTC TGG Intergenic
No off target data available for this crispr