ID: 1136678396

View in Genome Browser
Species Human (GRCh38)
Location 16:31937362-31937384
Sequence TGCCCTGCAAAAATGCTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136678393_1136678396 9 Left 1136678393 16:31937330-31937352 CCTGGAGGGCAGTTGTTTTTTAC No data
Right 1136678396 16:31937362-31937384 TGCCCTGCAAAAATGCTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136678396 Original CRISPR TGCCCTGCAAAAATGCTAAA AGG Intergenic
No off target data available for this crispr