ID: 1136683879

View in Genome Browser
Species Human (GRCh38)
Location 16:31983117-31983139
Sequence GACTTTGTGTGGGTGTCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136683879_1136683891 14 Left 1136683879 16:31983117-31983139 CCTTGAGACACCCACACAAAGTC No data
Right 1136683891 16:31983154-31983176 GGCCTGGGGTCTCTGCCAAGAGG No data
1136683879_1136683895 22 Left 1136683879 16:31983117-31983139 CCTTGAGACACCCACACAAAGTC No data
Right 1136683895 16:31983162-31983184 GTCTCTGCCAAGAGGGCAGTGGG No data
1136683879_1136683885 -7 Left 1136683879 16:31983117-31983139 CCTTGAGACACCCACACAAAGTC No data
Right 1136683885 16:31983133-31983155 CAAAGTCATGTGGGCGTCCCGGG No data
1136683879_1136683894 21 Left 1136683879 16:31983117-31983139 CCTTGAGACACCCACACAAAGTC No data
Right 1136683894 16:31983161-31983183 GGTCTCTGCCAAGAGGGCAGTGG No data
1136683879_1136683888 0 Left 1136683879 16:31983117-31983139 CCTTGAGACACCCACACAAAGTC No data
Right 1136683888 16:31983140-31983162 ATGTGGGCGTCCCGGGCCTGGGG No data
1136683879_1136683896 27 Left 1136683879 16:31983117-31983139 CCTTGAGACACCCACACAAAGTC No data
Right 1136683896 16:31983167-31983189 TGCCAAGAGGGCAGTGGGCCTGG No data
1136683879_1136683886 -2 Left 1136683879 16:31983117-31983139 CCTTGAGACACCCACACAAAGTC No data
Right 1136683886 16:31983138-31983160 TCATGTGGGCGTCCCGGGCCTGG No data
1136683879_1136683897 28 Left 1136683879 16:31983117-31983139 CCTTGAGACACCCACACAAAGTC No data
Right 1136683897 16:31983168-31983190 GCCAAGAGGGCAGTGGGCCTGGG No data
1136683879_1136683884 -8 Left 1136683879 16:31983117-31983139 CCTTGAGACACCCACACAAAGTC No data
Right 1136683884 16:31983132-31983154 ACAAAGTCATGTGGGCGTCCCGG No data
1136683879_1136683887 -1 Left 1136683879 16:31983117-31983139 CCTTGAGACACCCACACAAAGTC No data
Right 1136683887 16:31983139-31983161 CATGTGGGCGTCCCGGGCCTGGG No data
1136683879_1136683892 15 Left 1136683879 16:31983117-31983139 CCTTGAGACACCCACACAAAGTC No data
Right 1136683892 16:31983155-31983177 GCCTGGGGTCTCTGCCAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136683879 Original CRISPR GACTTTGTGTGGGTGTCTCA AGG (reversed) Intergenic
No off target data available for this crispr