ID: 1136683883

View in Genome Browser
Species Human (GRCh38)
Location 16:31983128-31983150
Sequence GACGCCCACATGACTTTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136683883_1136683897 17 Left 1136683883 16:31983128-31983150 CCACACAAAGTCATGTGGGCGTC No data
Right 1136683897 16:31983168-31983190 GCCAAGAGGGCAGTGGGCCTGGG No data
1136683883_1136683892 4 Left 1136683883 16:31983128-31983150 CCACACAAAGTCATGTGGGCGTC No data
Right 1136683892 16:31983155-31983177 GCCTGGGGTCTCTGCCAAGAGGG No data
1136683883_1136683895 11 Left 1136683883 16:31983128-31983150 CCACACAAAGTCATGTGGGCGTC No data
Right 1136683895 16:31983162-31983184 GTCTCTGCCAAGAGGGCAGTGGG No data
1136683883_1136683899 27 Left 1136683883 16:31983128-31983150 CCACACAAAGTCATGTGGGCGTC No data
Right 1136683899 16:31983178-31983200 CAGTGGGCCTGGGCCTGCTCTGG No data
1136683883_1136683896 16 Left 1136683883 16:31983128-31983150 CCACACAAAGTCATGTGGGCGTC No data
Right 1136683896 16:31983167-31983189 TGCCAAGAGGGCAGTGGGCCTGG No data
1136683883_1136683894 10 Left 1136683883 16:31983128-31983150 CCACACAAAGTCATGTGGGCGTC No data
Right 1136683894 16:31983161-31983183 GGTCTCTGCCAAGAGGGCAGTGG No data
1136683883_1136683891 3 Left 1136683883 16:31983128-31983150 CCACACAAAGTCATGTGGGCGTC No data
Right 1136683891 16:31983154-31983176 GGCCTGGGGTCTCTGCCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136683883 Original CRISPR GACGCCCACATGACTTTGTG TGG (reversed) Intergenic
No off target data available for this crispr