ID: 1136683890

View in Genome Browser
Species Human (GRCh38)
Location 16:31983151-31983173
Sequence CTTGGCAGAGACCCCAGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136683890_1136683905 16 Left 1136683890 16:31983151-31983173 CCGGGCCTGGGGTCTCTGCCAAG No data
Right 1136683905 16:31983190-31983212 GCCTGCTCTGGCCGTGGGAGGGG No data
1136683890_1136683896 -7 Left 1136683890 16:31983151-31983173 CCGGGCCTGGGGTCTCTGCCAAG No data
Right 1136683896 16:31983167-31983189 TGCCAAGAGGGCAGTGGGCCTGG No data
1136683890_1136683899 4 Left 1136683890 16:31983151-31983173 CCGGGCCTGGGGTCTCTGCCAAG No data
Right 1136683899 16:31983178-31983200 CAGTGGGCCTGGGCCTGCTCTGG No data
1136683890_1136683903 14 Left 1136683890 16:31983151-31983173 CCGGGCCTGGGGTCTCTGCCAAG No data
Right 1136683903 16:31983188-31983210 GGGCCTGCTCTGGCCGTGGGAGG No data
1136683890_1136683907 17 Left 1136683890 16:31983151-31983173 CCGGGCCTGGGGTCTCTGCCAAG No data
Right 1136683907 16:31983191-31983213 CCTGCTCTGGCCGTGGGAGGGGG No data
1136683890_1136683904 15 Left 1136683890 16:31983151-31983173 CCGGGCCTGGGGTCTCTGCCAAG No data
Right 1136683904 16:31983189-31983211 GGCCTGCTCTGGCCGTGGGAGGG No data
1136683890_1136683902 11 Left 1136683890 16:31983151-31983173 CCGGGCCTGGGGTCTCTGCCAAG No data
Right 1136683902 16:31983185-31983207 CCTGGGCCTGCTCTGGCCGTGGG No data
1136683890_1136683908 18 Left 1136683890 16:31983151-31983173 CCGGGCCTGGGGTCTCTGCCAAG No data
Right 1136683908 16:31983192-31983214 CTGCTCTGGCCGTGGGAGGGGGG No data
1136683890_1136683897 -6 Left 1136683890 16:31983151-31983173 CCGGGCCTGGGGTCTCTGCCAAG No data
Right 1136683897 16:31983168-31983190 GCCAAGAGGGCAGTGGGCCTGGG No data
1136683890_1136683909 19 Left 1136683890 16:31983151-31983173 CCGGGCCTGGGGTCTCTGCCAAG No data
Right 1136683909 16:31983193-31983215 TGCTCTGGCCGTGGGAGGGGGGG No data
1136683890_1136683911 30 Left 1136683890 16:31983151-31983173 CCGGGCCTGGGGTCTCTGCCAAG No data
Right 1136683911 16:31983204-31983226 TGGGAGGGGGGGCTACTGCATGG No data
1136683890_1136683900 10 Left 1136683890 16:31983151-31983173 CCGGGCCTGGGGTCTCTGCCAAG No data
Right 1136683900 16:31983184-31983206 GCCTGGGCCTGCTCTGGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136683890 Original CRISPR CTTGGCAGAGACCCCAGGCC CGG (reversed) Intergenic
No off target data available for this crispr