ID: 1136683893

View in Genome Browser
Species Human (GRCh38)
Location 16:31983156-31983178
Sequence GCCCTCTTGGCAGAGACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136683893_1136683899 -1 Left 1136683893 16:31983156-31983178 CCTGGGGTCTCTGCCAAGAGGGC No data
Right 1136683899 16:31983178-31983200 CAGTGGGCCTGGGCCTGCTCTGG No data
1136683893_1136683905 11 Left 1136683893 16:31983156-31983178 CCTGGGGTCTCTGCCAAGAGGGC No data
Right 1136683905 16:31983190-31983212 GCCTGCTCTGGCCGTGGGAGGGG No data
1136683893_1136683909 14 Left 1136683893 16:31983156-31983178 CCTGGGGTCTCTGCCAAGAGGGC No data
Right 1136683909 16:31983193-31983215 TGCTCTGGCCGTGGGAGGGGGGG No data
1136683893_1136683902 6 Left 1136683893 16:31983156-31983178 CCTGGGGTCTCTGCCAAGAGGGC No data
Right 1136683902 16:31983185-31983207 CCTGGGCCTGCTCTGGCCGTGGG No data
1136683893_1136683903 9 Left 1136683893 16:31983156-31983178 CCTGGGGTCTCTGCCAAGAGGGC No data
Right 1136683903 16:31983188-31983210 GGGCCTGCTCTGGCCGTGGGAGG No data
1136683893_1136683907 12 Left 1136683893 16:31983156-31983178 CCTGGGGTCTCTGCCAAGAGGGC No data
Right 1136683907 16:31983191-31983213 CCTGCTCTGGCCGTGGGAGGGGG No data
1136683893_1136683904 10 Left 1136683893 16:31983156-31983178 CCTGGGGTCTCTGCCAAGAGGGC No data
Right 1136683904 16:31983189-31983211 GGCCTGCTCTGGCCGTGGGAGGG No data
1136683893_1136683911 25 Left 1136683893 16:31983156-31983178 CCTGGGGTCTCTGCCAAGAGGGC No data
Right 1136683911 16:31983204-31983226 TGGGAGGGGGGGCTACTGCATGG No data
1136683893_1136683900 5 Left 1136683893 16:31983156-31983178 CCTGGGGTCTCTGCCAAGAGGGC No data
Right 1136683900 16:31983184-31983206 GCCTGGGCCTGCTCTGGCCGTGG No data
1136683893_1136683908 13 Left 1136683893 16:31983156-31983178 CCTGGGGTCTCTGCCAAGAGGGC No data
Right 1136683908 16:31983192-31983214 CTGCTCTGGCCGTGGGAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136683893 Original CRISPR GCCCTCTTGGCAGAGACCCC AGG (reversed) Intergenic
No off target data available for this crispr