ID: 1136683895

View in Genome Browser
Species Human (GRCh38)
Location 16:31983162-31983184
Sequence GTCTCTGCCAAGAGGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136683883_1136683895 11 Left 1136683883 16:31983128-31983150 CCACACAAAGTCATGTGGGCGTC No data
Right 1136683895 16:31983162-31983184 GTCTCTGCCAAGAGGGCAGTGGG No data
1136683879_1136683895 22 Left 1136683879 16:31983117-31983139 CCTTGAGACACCCACACAAAGTC No data
Right 1136683895 16:31983162-31983184 GTCTCTGCCAAGAGGGCAGTGGG No data
1136683882_1136683895 12 Left 1136683882 16:31983127-31983149 CCCACACAAAGTCATGTGGGCGT No data
Right 1136683895 16:31983162-31983184 GTCTCTGCCAAGAGGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136683895 Original CRISPR GTCTCTGCCAAGAGGGCAGT GGG Intergenic
No off target data available for this crispr