ID: 1136683896

View in Genome Browser
Species Human (GRCh38)
Location 16:31983167-31983189
Sequence TGCCAAGAGGGCAGTGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136683879_1136683896 27 Left 1136683879 16:31983117-31983139 CCTTGAGACACCCACACAAAGTC No data
Right 1136683896 16:31983167-31983189 TGCCAAGAGGGCAGTGGGCCTGG No data
1136683890_1136683896 -7 Left 1136683890 16:31983151-31983173 CCGGGCCTGGGGTCTCTGCCAAG No data
Right 1136683896 16:31983167-31983189 TGCCAAGAGGGCAGTGGGCCTGG No data
1136683889_1136683896 -6 Left 1136683889 16:31983150-31983172 CCCGGGCCTGGGGTCTCTGCCAA No data
Right 1136683896 16:31983167-31983189 TGCCAAGAGGGCAGTGGGCCTGG No data
1136683883_1136683896 16 Left 1136683883 16:31983128-31983150 CCACACAAAGTCATGTGGGCGTC No data
Right 1136683896 16:31983167-31983189 TGCCAAGAGGGCAGTGGGCCTGG No data
1136683882_1136683896 17 Left 1136683882 16:31983127-31983149 CCCACACAAAGTCATGTGGGCGT No data
Right 1136683896 16:31983167-31983189 TGCCAAGAGGGCAGTGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136683896 Original CRISPR TGCCAAGAGGGCAGTGGGCC TGG Intergenic
No off target data available for this crispr