ID: 1136683904

View in Genome Browser
Species Human (GRCh38)
Location 16:31983189-31983211
Sequence GGCCTGCTCTGGCCGTGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136683898_1136683904 -3 Left 1136683898 16:31983169-31983191 CCAAGAGGGCAGTGGGCCTGGGC No data
Right 1136683904 16:31983189-31983211 GGCCTGCTCTGGCCGTGGGAGGG No data
1136683890_1136683904 15 Left 1136683890 16:31983151-31983173 CCGGGCCTGGGGTCTCTGCCAAG No data
Right 1136683904 16:31983189-31983211 GGCCTGCTCTGGCCGTGGGAGGG No data
1136683889_1136683904 16 Left 1136683889 16:31983150-31983172 CCCGGGCCTGGGGTCTCTGCCAA No data
Right 1136683904 16:31983189-31983211 GGCCTGCTCTGGCCGTGGGAGGG No data
1136683893_1136683904 10 Left 1136683893 16:31983156-31983178 CCTGGGGTCTCTGCCAAGAGGGC No data
Right 1136683904 16:31983189-31983211 GGCCTGCTCTGGCCGTGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136683904 Original CRISPR GGCCTGCTCTGGCCGTGGGA GGG Intergenic
No off target data available for this crispr