ID: 1136683909

View in Genome Browser
Species Human (GRCh38)
Location 16:31983193-31983215
Sequence TGCTCTGGCCGTGGGAGGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136683890_1136683909 19 Left 1136683890 16:31983151-31983173 CCGGGCCTGGGGTCTCTGCCAAG No data
Right 1136683909 16:31983193-31983215 TGCTCTGGCCGTGGGAGGGGGGG No data
1136683898_1136683909 1 Left 1136683898 16:31983169-31983191 CCAAGAGGGCAGTGGGCCTGGGC No data
Right 1136683909 16:31983193-31983215 TGCTCTGGCCGTGGGAGGGGGGG No data
1136683893_1136683909 14 Left 1136683893 16:31983156-31983178 CCTGGGGTCTCTGCCAAGAGGGC No data
Right 1136683909 16:31983193-31983215 TGCTCTGGCCGTGGGAGGGGGGG No data
1136683889_1136683909 20 Left 1136683889 16:31983150-31983172 CCCGGGCCTGGGGTCTCTGCCAA No data
Right 1136683909 16:31983193-31983215 TGCTCTGGCCGTGGGAGGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136683909 Original CRISPR TGCTCTGGCCGTGGGAGGGG GGG Intergenic
No off target data available for this crispr