ID: 1136683911

View in Genome Browser
Species Human (GRCh38)
Location 16:31983204-31983226
Sequence TGGGAGGGGGGGCTACTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136683890_1136683911 30 Left 1136683890 16:31983151-31983173 CCGGGCCTGGGGTCTCTGCCAAG No data
Right 1136683911 16:31983204-31983226 TGGGAGGGGGGGCTACTGCATGG No data
1136683901_1136683911 -4 Left 1136683901 16:31983185-31983207 CCTGGGCCTGCTCTGGCCGTGGG No data
Right 1136683911 16:31983204-31983226 TGGGAGGGGGGGCTACTGCATGG No data
1136683898_1136683911 12 Left 1136683898 16:31983169-31983191 CCAAGAGGGCAGTGGGCCTGGGC No data
Right 1136683911 16:31983204-31983226 TGGGAGGGGGGGCTACTGCATGG No data
1136683893_1136683911 25 Left 1136683893 16:31983156-31983178 CCTGGGGTCTCTGCCAAGAGGGC No data
Right 1136683911 16:31983204-31983226 TGGGAGGGGGGGCTACTGCATGG No data
1136683906_1136683911 -10 Left 1136683906 16:31983191-31983213 CCTGCTCTGGCCGTGGGAGGGGG No data
Right 1136683911 16:31983204-31983226 TGGGAGGGGGGGCTACTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136683911 Original CRISPR TGGGAGGGGGGGCTACTGCA TGG Intergenic
No off target data available for this crispr