ID: 1136683956

View in Genome Browser
Species Human (GRCh38)
Location 16:31983408-31983430
Sequence CATGGAGGAGGTGCCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136683956_1136683963 4 Left 1136683956 16:31983408-31983430 CCTCCTGGGGCACCTCCTCCATG No data
Right 1136683963 16:31983435-31983457 CTCAGCATCTGCCAGGAAAGTGG No data
1136683956_1136683961 -3 Left 1136683956 16:31983408-31983430 CCTCCTGGGGCACCTCCTCCATG No data
Right 1136683961 16:31983428-31983450 ATGCCTGCTCAGCATCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136683956 Original CRISPR CATGGAGGAGGTGCCCCAGG AGG (reversed) Intergenic
No off target data available for this crispr