ID: 1136685404

View in Genome Browser
Species Human (GRCh38)
Location 16:31991247-31991269
Sequence GATACAGACGTGCCTGCGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136685399_1136685404 3 Left 1136685399 16:31991221-31991243 CCTGGCCCTCTTATATGCATGGC No data
Right 1136685404 16:31991247-31991269 GATACAGACGTGCCTGCGTGGGG No data
1136685401_1136685404 -3 Left 1136685401 16:31991227-31991249 CCTCTTATATGCATGGCAGAGAT No data
Right 1136685404 16:31991247-31991269 GATACAGACGTGCCTGCGTGGGG No data
1136685400_1136685404 -2 Left 1136685400 16:31991226-31991248 CCCTCTTATATGCATGGCAGAGA No data
Right 1136685404 16:31991247-31991269 GATACAGACGTGCCTGCGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136685404 Original CRISPR GATACAGACGTGCCTGCGTG GGG Intergenic
No off target data available for this crispr