ID: 1136686214

View in Genome Browser
Species Human (GRCh38)
Location 16:31996296-31996318
Sequence CTGGCCCCACTGAGGTTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136686200_1136686214 27 Left 1136686200 16:31996246-31996268 CCAAGGTCTGGCCTGACATCAGG No data
Right 1136686214 16:31996296-31996318 CTGGCCCCACTGAGGTTTTGGGG No data
1136686204_1136686214 16 Left 1136686204 16:31996257-31996279 CCTGACATCAGGAGGCCCCGGCT No data
Right 1136686214 16:31996296-31996318 CTGGCCCCACTGAGGTTTTGGGG No data
1136686205_1136686214 1 Left 1136686205 16:31996272-31996294 CCCCGGCTCTAGTGACTTTCCCT No data
Right 1136686214 16:31996296-31996318 CTGGCCCCACTGAGGTTTTGGGG No data
1136686207_1136686214 -1 Left 1136686207 16:31996274-31996296 CCGGCTCTAGTGACTTTCCCTGC No data
Right 1136686214 16:31996296-31996318 CTGGCCCCACTGAGGTTTTGGGG No data
1136686206_1136686214 0 Left 1136686206 16:31996273-31996295 CCCGGCTCTAGTGACTTTCCCTG No data
Right 1136686214 16:31996296-31996318 CTGGCCCCACTGAGGTTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136686214 Original CRISPR CTGGCCCCACTGAGGTTTTG GGG Intergenic
No off target data available for this crispr