ID: 1136687205

View in Genome Browser
Species Human (GRCh38)
Location 16:32002618-32002640
Sequence GGTCCCTGCCCCAGTGAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136687203_1136687205 -4 Left 1136687203 16:32002599-32002621 CCCGGCTGATGAGGGAGACGGTC No data
Right 1136687205 16:32002618-32002640 GGTCCCTGCCCCAGTGAGCCCGG No data
1136687199_1136687205 7 Left 1136687199 16:32002588-32002610 CCTCAAGAGCACCCGGCTGATGA No data
Right 1136687205 16:32002618-32002640 GGTCCCTGCCCCAGTGAGCCCGG No data
1136687204_1136687205 -5 Left 1136687204 16:32002600-32002622 CCGGCTGATGAGGGAGACGGTCC No data
Right 1136687205 16:32002618-32002640 GGTCCCTGCCCCAGTGAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136687205 Original CRISPR GGTCCCTGCCCCAGTGAGCC CGG Intergenic
No off target data available for this crispr