ID: 1136687224

View in Genome Browser
Species Human (GRCh38)
Location 16:32002673-32002695
Sequence GGCACCCCCCTCTGGGGGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136687210_1136687224 23 Left 1136687210 16:32002627-32002649 CCCAGTGAGCCCGGTCTGATGGA No data
Right 1136687224 16:32002673-32002695 GGCACCCCCCTCTGGGGGGTCGG No data
1136687214_1136687224 13 Left 1136687214 16:32002637-32002659 CCGGTCTGATGGAGGAGACACGG No data
Right 1136687224 16:32002673-32002695 GGCACCCCCCTCTGGGGGGTCGG No data
1136687206_1136687224 29 Left 1136687206 16:32002621-32002643 CCCTGCCCCAGTGAGCCCGGTCT No data
Right 1136687224 16:32002673-32002695 GGCACCCCCCTCTGGGGGGTCGG No data
1136687211_1136687224 22 Left 1136687211 16:32002628-32002650 CCAGTGAGCCCGGTCTGATGGAG No data
Right 1136687224 16:32002673-32002695 GGCACCCCCCTCTGGGGGGTCGG No data
1136687208_1136687224 24 Left 1136687208 16:32002626-32002648 CCCCAGTGAGCCCGGTCTGATGG No data
Right 1136687224 16:32002673-32002695 GGCACCCCCCTCTGGGGGGTCGG No data
1136687213_1136687224 14 Left 1136687213 16:32002636-32002658 CCCGGTCTGATGGAGGAGACACG No data
Right 1136687224 16:32002673-32002695 GGCACCCCCCTCTGGGGGGTCGG No data
1136687207_1136687224 28 Left 1136687207 16:32002622-32002644 CCTGCCCCAGTGAGCCCGGTCTG No data
Right 1136687224 16:32002673-32002695 GGCACCCCCCTCTGGGGGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136687224 Original CRISPR GGCACCCCCCTCTGGGGGGT CGG Intergenic
No off target data available for this crispr