ID: 1136690463

View in Genome Browser
Species Human (GRCh38)
Location 16:32024890-32024912
Sequence TGGGCTTCCCCCGAGCGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136690452_1136690463 23 Left 1136690452 16:32024844-32024866 CCATAAATGTGCAGGAACCAAAG No data
Right 1136690463 16:32024890-32024912 TGGGCTTCCCCCGAGCGGGTGGG No data
1136690449_1136690463 29 Left 1136690449 16:32024838-32024860 CCCGGCCCATAAATGTGCAGGAA No data
Right 1136690463 16:32024890-32024912 TGGGCTTCCCCCGAGCGGGTGGG No data
1136690455_1136690463 6 Left 1136690455 16:32024861-32024883 CCAAAGGGAAAGAAAGATGCAAA No data
Right 1136690463 16:32024890-32024912 TGGGCTTCCCCCGAGCGGGTGGG No data
1136690451_1136690463 24 Left 1136690451 16:32024843-32024865 CCCATAAATGTGCAGGAACCAAA No data
Right 1136690463 16:32024890-32024912 TGGGCTTCCCCCGAGCGGGTGGG No data
1136690450_1136690463 28 Left 1136690450 16:32024839-32024861 CCGGCCCATAAATGTGCAGGAAC No data
Right 1136690463 16:32024890-32024912 TGGGCTTCCCCCGAGCGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136690463 Original CRISPR TGGGCTTCCCCCGAGCGGGT GGG Intergenic
No off target data available for this crispr