ID: 1136691983

View in Genome Browser
Species Human (GRCh38)
Location 16:32039270-32039292
Sequence GTGTCCTGAGCGCCCCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136691983_1136692000 1 Left 1136691983 16:32039270-32039292 CCACCAGGGGGCGCTCAGGACAC No data
Right 1136692000 16:32039294-32039316 GGGGGGGGGTGTGGCGGGGGGGG No data
1136691983_1136691999 0 Left 1136691983 16:32039270-32039292 CCACCAGGGGGCGCTCAGGACAC No data
Right 1136691999 16:32039293-32039315 TGGGGGGGGGTGTGGCGGGGGGG No data
1136691983_1136691993 -8 Left 1136691983 16:32039270-32039292 CCACCAGGGGGCGCTCAGGACAC No data
Right 1136691993 16:32039285-32039307 CAGGACACTGGGGGGGGGTGTGG No data
1136691983_1136691998 -1 Left 1136691983 16:32039270-32039292 CCACCAGGGGGCGCTCAGGACAC No data
Right 1136691998 16:32039292-32039314 CTGGGGGGGGGTGTGGCGGGGGG No data
1136691983_1136692003 21 Left 1136691983 16:32039270-32039292 CCACCAGGGGGCGCTCAGGACAC No data
Right 1136692003 16:32039314-32039336 GGGTCACAGAGAACCACAAGGGG No data
1136691983_1136692004 22 Left 1136691983 16:32039270-32039292 CCACCAGGGGGCGCTCAGGACAC No data
Right 1136692004 16:32039315-32039337 GGTCACAGAGAACCACAAGGGGG No data
1136691983_1136692001 19 Left 1136691983 16:32039270-32039292 CCACCAGGGGGCGCTCAGGACAC No data
Right 1136692001 16:32039312-32039334 GGGGGTCACAGAGAACCACAAGG No data
1136691983_1136691997 -2 Left 1136691983 16:32039270-32039292 CCACCAGGGGGCGCTCAGGACAC No data
Right 1136691997 16:32039291-32039313 ACTGGGGGGGGGTGTGGCGGGGG No data
1136691983_1136691994 -5 Left 1136691983 16:32039270-32039292 CCACCAGGGGGCGCTCAGGACAC No data
Right 1136691994 16:32039288-32039310 GACACTGGGGGGGGGTGTGGCGG No data
1136691983_1136691995 -4 Left 1136691983 16:32039270-32039292 CCACCAGGGGGCGCTCAGGACAC No data
Right 1136691995 16:32039289-32039311 ACACTGGGGGGGGGTGTGGCGGG No data
1136691983_1136692002 20 Left 1136691983 16:32039270-32039292 CCACCAGGGGGCGCTCAGGACAC No data
Right 1136692002 16:32039313-32039335 GGGGTCACAGAGAACCACAAGGG No data
1136691983_1136691996 -3 Left 1136691983 16:32039270-32039292 CCACCAGGGGGCGCTCAGGACAC No data
Right 1136691996 16:32039290-32039312 CACTGGGGGGGGGTGTGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136691983 Original CRISPR GTGTCCTGAGCGCCCCCTGG TGG (reversed) Intergenic
No off target data available for this crispr