ID: 1136692004

View in Genome Browser
Species Human (GRCh38)
Location 16:32039315-32039337
Sequence GGTCACAGAGAACCACAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136691983_1136692004 22 Left 1136691983 16:32039270-32039292 CCACCAGGGGGCGCTCAGGACAC No data
Right 1136692004 16:32039315-32039337 GGTCACAGAGAACCACAAGGGGG No data
1136691984_1136692004 19 Left 1136691984 16:32039273-32039295 CCAGGGGGCGCTCAGGACACTGG No data
Right 1136692004 16:32039315-32039337 GGTCACAGAGAACCACAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136692004 Original CRISPR GGTCACAGAGAACCACAAGG GGG Intergenic
No off target data available for this crispr