ID: 1136702818

View in Genome Browser
Species Human (GRCh38)
Location 16:32158782-32158804
Sequence GCACGTGGCCATCAGCTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136702816_1136702818 6 Left 1136702816 16:32158753-32158775 CCTAACTACTGGGTTCAGGGCAC No data
Right 1136702818 16:32158782-32158804 GCACGTGGCCATCAGCTCACAGG No data
1136702809_1136702818 21 Left 1136702809 16:32158738-32158760 CCCATGAAGTATATCCCTAACTA No data
Right 1136702818 16:32158782-32158804 GCACGTGGCCATCAGCTCACAGG No data
1136702810_1136702818 20 Left 1136702810 16:32158739-32158761 CCATGAAGTATATCCCTAACTAC No data
Right 1136702818 16:32158782-32158804 GCACGTGGCCATCAGCTCACAGG No data
1136702808_1136702818 28 Left 1136702808 16:32158731-32158753 CCACAGGCCCATGAAGTATATCC No data
Right 1136702818 16:32158782-32158804 GCACGTGGCCATCAGCTCACAGG No data
1136702815_1136702818 7 Left 1136702815 16:32158752-32158774 CCCTAACTACTGGGTTCAGGGCA No data
Right 1136702818 16:32158782-32158804 GCACGTGGCCATCAGCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136702818 Original CRISPR GCACGTGGCCATCAGCTCAC AGG Intergenic
No off target data available for this crispr