ID: 1136704653

View in Genome Browser
Species Human (GRCh38)
Location 16:32176944-32176966
Sequence CCTGCTAACCAGACAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136704649_1136704653 -5 Left 1136704649 16:32176926-32176948 CCTGTACAAATTGTACCTCCTGC No data
Right 1136704653 16:32176944-32176966 CCTGCTAACCAGACAGCAGAGGG No data
1136704648_1136704653 -1 Left 1136704648 16:32176922-32176944 CCTTCCTGTACAAATTGTACCTC No data
Right 1136704653 16:32176944-32176966 CCTGCTAACCAGACAGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136704653 Original CRISPR CCTGCTAACCAGACAGCAGA GGG Intergenic
No off target data available for this crispr