ID: 1136719718

View in Genome Browser
Species Human (GRCh38)
Location 16:32310392-32310414
Sequence TATGGAGCAATCGCCGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 2, 1: 3, 2: 5, 3: 8, 4: 17}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136719718_1136719723 -8 Left 1136719718 16:32310392-32310414 CCAGCGGCGGCGATTGCTCCATA 0: 2
1: 3
2: 5
3: 8
4: 17
Right 1136719723 16:32310407-32310429 GCTCCATATCCACGGGGTCCGGG No data
1136719718_1136719731 29 Left 1136719718 16:32310392-32310414 CCAGCGGCGGCGATTGCTCCATA 0: 2
1: 3
2: 5
3: 8
4: 17
Right 1136719731 16:32310444-32310466 ATCTAACGGTCCCGCCAGCTAGG No data
1136719718_1136719728 15 Left 1136719718 16:32310392-32310414 CCAGCGGCGGCGATTGCTCCATA 0: 2
1: 3
2: 5
3: 8
4: 17
Right 1136719728 16:32310430-32310452 CCGCATCCGCCTCGATCTAACGG No data
1136719718_1136719722 -9 Left 1136719718 16:32310392-32310414 CCAGCGGCGGCGATTGCTCCATA 0: 2
1: 3
2: 5
3: 8
4: 17
Right 1136719722 16:32310406-32310428 TGCTCCATATCCACGGGGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136719718 Original CRISPR TATGGAGCAATCGCCGCCGC TGG (reversed) Intergenic
900777428 1:4595415-4595437 GAAGGAGCAAACGCAGCCGCTGG - Intergenic
906936064 1:50214919-50214941 TATGGGGCAATCCCAGCAGCAGG + Intergenic
923191138 1:231621948-231621970 TATGGACCAATAGCAGCCCCAGG - Intronic
1065993164 10:31032080-31032102 GGTAGAGCAGTCGCCGCCGCAGG - Intergenic
1066758086 10:38730395-38730417 TATGGGGCAGTCGCCGCCTCCGG + Intergenic
1066963604 10:42242298-42242320 TATGGAGCAGTCGCCGCCGCCGG - Intergenic
1103385494 12:120529094-120529116 TATGGAGCTATTGCGGCCGTGGG - Exonic
1123441488 15:20295128-20295150 TATGGAGCAGTGGCCGCCGCCGG + Intergenic
1132419244 15:101651756-101651778 TTTAGAGCAATCGCAGGCGCTGG - Exonic
1136719718 16:32310392-32310414 TATGGAGCAATCGCCGCCGCTGG - Intergenic
1136724757 16:32348791-32348813 TGTGGAGCAGTCGCCGCTGCCGG - Intergenic
1136838093 16:33516672-33516694 TATGGAGCAGTCGCCGCCGCTGG - Intergenic
1136843083 16:33554831-33554853 TGTGGAGCAGTCGCCGCTGCCGG - Intergenic
1203001673 16_KI270728v1_random:168964-168986 TGTGGAGCAGTCGCCGCTGCCGG + Intergenic
1203006713 16_KI270728v1_random:207377-207399 TATGGAGCAATCGCCGCCGCTGG + Intergenic
1203133277 16_KI270728v1_random:1705370-1705392 TGTGGAGCAGTCGCCGCTGCCGG + Intergenic
1203148266 16_KI270728v1_random:1816952-1816974 TATGGAGCAGTCGCCGCCGCTGG - Intergenic
1203153248 16_KI270728v1_random:1855129-1855151 TGTGGAGCAGTCGCCGCTGCCGG - Intergenic
927960696 2:27239160-27239182 TGTGGTGCAATCGCTGCAGCAGG - Exonic
934321401 2:91974835-91974857 TATGGAGCAGTCGTCGCCGCCGG + Intergenic
944457511 2:199911054-199911076 TATGGAGCATGCGCAGCAGCAGG - Intergenic
1176373465 21:6076083-6076105 TCTGGGGCAATCGCCGCTGTTGG - Intergenic
1179750012 21:43462160-43462182 TCTGGGGCAATCGCCGCTGTTGG + Intergenic
1180309647 22:11158804-11158826 TATGGAGCAGTCGCCGCCCCCGG + Intergenic
1180548124 22:16520614-16520636 TATGGAGCAGTCGCCGCCCCCGG + Intergenic
1182211316 22:28679702-28679724 GATGGAGCAGTCGCCGCCGCCGG - Exonic
954150804 3:48656153-48656175 TAAGGTGGAATCGCTGCCGCAGG + Exonic
979565796 4:122152694-122152716 TATGAAGGAGTCGCCGCCGCAGG - Intronic
979765935 4:124463799-124463821 CATGGAGCAGTAGCCGCCGTGGG - Intergenic
983996934 4:174193586-174193608 TATGGAGAAATTGCCACAGCAGG + Intergenic
985724872 5:1510857-1510879 TCTGGAGCAAGGGCCGCTGCTGG + Intronic
1030002862 7:105084101-105084123 TGTGGAGCCATCACCGCAGCTGG - Intronic
1049194594 8:141308384-141308406 TATGCAGCACCCGCCGCCGCGGG + Intergenic
1060389958 9:123268806-123268828 CAGGGAGCACTCGCCGCCGGCGG + Intergenic
1060811703 9:126614150-126614172 TCTGCAGCAGCCGCCGCCGCCGG + Intergenic