ID: 1136719749

View in Genome Browser
Species Human (GRCh38)
Location 16:32310533-32310555
Sequence GGGGGCGCGCGCGCGGTTAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 3, 1: 2, 2: 1, 3: 13, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136719749 Original CRISPR GGGGGCGCGCGCGCGGTTAG CGG (reversed) Intergenic