ID: 1136720316

View in Genome Browser
Species Human (GRCh38)
Location 16:32314753-32314775
Sequence AAACATGAACAAATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136720316_1136720319 5 Left 1136720316 16:32314753-32314775 CCCAGCTCCATTTGTTCATGTTT No data
Right 1136720319 16:32314781-32314803 TCTTACACCCACCTCTAGCTAGG No data
1136720316_1136720320 6 Left 1136720316 16:32314753-32314775 CCCAGCTCCATTTGTTCATGTTT No data
Right 1136720320 16:32314782-32314804 CTTACACCCACCTCTAGCTAGGG No data
1136720316_1136720325 15 Left 1136720316 16:32314753-32314775 CCCAGCTCCATTTGTTCATGTTT No data
Right 1136720325 16:32314791-32314813 ACCTCTAGCTAGGGGCCAGTGGG No data
1136720316_1136720327 28 Left 1136720316 16:32314753-32314775 CCCAGCTCCATTTGTTCATGTTT No data
Right 1136720327 16:32314804-32314826 GGCCAGTGGGAACCGCTCCACGG No data
1136720316_1136720321 7 Left 1136720316 16:32314753-32314775 CCCAGCTCCATTTGTTCATGTTT No data
Right 1136720321 16:32314783-32314805 TTACACCCACCTCTAGCTAGGGG No data
1136720316_1136720324 14 Left 1136720316 16:32314753-32314775 CCCAGCTCCATTTGTTCATGTTT No data
Right 1136720324 16:32314790-32314812 CACCTCTAGCTAGGGGCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136720316 Original CRISPR AAACATGAACAAATGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr