ID: 1136724748

View in Genome Browser
Species Human (GRCh38)
Location 16:32348756-32348778
Sequence CCCCAGGGCCGACCCCCGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136724748_1136724760 26 Left 1136724748 16:32348756-32348778 CCTTGCGGGGGTCGGCCCTGGGG No data
Right 1136724760 16:32348805-32348827 TGCTCCACATCCACCGGGTCCGG No data
1136724748_1136724755 -7 Left 1136724748 16:32348756-32348778 CCTTGCGGGGGTCGGCCCTGGGG No data
Right 1136724755 16:32348772-32348794 CCTGGGGTCGGCTTGGGCGCCGG No data
1136724748_1136724761 27 Left 1136724748 16:32348756-32348778 CCTTGCGGGGGTCGGCCCTGGGG No data
Right 1136724761 16:32348806-32348828 GCTCCACATCCACCGGGTCCGGG No data
1136724748_1136724756 -1 Left 1136724748 16:32348756-32348778 CCTTGCGGGGGTCGGCCCTGGGG No data
Right 1136724756 16:32348778-32348800 GTCGGCTTGGGCGCCGGCAGCGG No data
1136724748_1136724759 21 Left 1136724748 16:32348756-32348778 CCTTGCGGGGGTCGGCCCTGGGG No data
Right 1136724759 16:32348800-32348822 GCGACTGCTCCACATCCACCGGG No data
1136724748_1136724758 20 Left 1136724748 16:32348756-32348778 CCTTGCGGGGGTCGGCCCTGGGG No data
Right 1136724758 16:32348799-32348821 GGCGACTGCTCCACATCCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136724748 Original CRISPR CCCCAGGGCCGACCCCCGCA AGG (reversed) Intergenic
No off target data available for this crispr