ID: 1136724753

View in Genome Browser
Species Human (GRCh38)
Location 16:32348771-32348793
Sequence CGGCGCCCAAGCCGACCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136724753_1136724761 12 Left 1136724753 16:32348771-32348793 CCCTGGGGTCGGCTTGGGCGCCG No data
Right 1136724761 16:32348806-32348828 GCTCCACATCCACCGGGTCCGGG No data
1136724753_1136724759 6 Left 1136724753 16:32348771-32348793 CCCTGGGGTCGGCTTGGGCGCCG No data
Right 1136724759 16:32348800-32348822 GCGACTGCTCCACATCCACCGGG No data
1136724753_1136724758 5 Left 1136724753 16:32348771-32348793 CCCTGGGGTCGGCTTGGGCGCCG No data
Right 1136724758 16:32348799-32348821 GGCGACTGCTCCACATCCACCGG No data
1136724753_1136724760 11 Left 1136724753 16:32348771-32348793 CCCTGGGGTCGGCTTGGGCGCCG No data
Right 1136724760 16:32348805-32348827 TGCTCCACATCCACCGGGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136724753 Original CRISPR CGGCGCCCAAGCCGACCCCA GGG (reversed) Intergenic
No off target data available for this crispr