ID: 1136724754

View in Genome Browser
Species Human (GRCh38)
Location 16:32348772-32348794
Sequence CCGGCGCCCAAGCCGACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136724754_1136724760 10 Left 1136724754 16:32348772-32348794 CCTGGGGTCGGCTTGGGCGCCGG No data
Right 1136724760 16:32348805-32348827 TGCTCCACATCCACCGGGTCCGG No data
1136724754_1136724759 5 Left 1136724754 16:32348772-32348794 CCTGGGGTCGGCTTGGGCGCCGG No data
Right 1136724759 16:32348800-32348822 GCGACTGCTCCACATCCACCGGG No data
1136724754_1136724758 4 Left 1136724754 16:32348772-32348794 CCTGGGGTCGGCTTGGGCGCCGG No data
Right 1136724758 16:32348799-32348821 GGCGACTGCTCCACATCCACCGG No data
1136724754_1136724761 11 Left 1136724754 16:32348772-32348794 CCTGGGGTCGGCTTGGGCGCCGG No data
Right 1136724761 16:32348806-32348828 GCTCCACATCCACCGGGTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136724754 Original CRISPR CCGGCGCCCAAGCCGACCCC AGG (reversed) Intergenic
No off target data available for this crispr