ID: 1136724757

View in Genome Browser
Species Human (GRCh38)
Location 16:32348791-32348813
Sequence TGTGGAGCAGTCGCCGCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136724757_1136724760 -9 Left 1136724757 16:32348791-32348813 CCGGCAGCGGCGACTGCTCCACA No data
Right 1136724760 16:32348805-32348827 TGCTCCACATCCACCGGGTCCGG No data
1136724757_1136724767 15 Left 1136724757 16:32348791-32348813 CCGGCAGCGGCGACTGCTCCACA No data
Right 1136724767 16:32348829-32348851 CCGCGTCCGCCTCGAGCTAACGG No data
1136724757_1136724761 -8 Left 1136724757 16:32348791-32348813 CCGGCAGCGGCGACTGCTCCACA No data
Right 1136724761 16:32348806-32348828 GCTCCACATCCACCGGGTCCGGG No data
1136724757_1136724770 29 Left 1136724757 16:32348791-32348813 CCGGCAGCGGCGACTGCTCCACA No data
Right 1136724770 16:32348843-32348865 AGCTAACGGTCCCGCCAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136724757 Original CRISPR TGTGGAGCAGTCGCCGCTGC CGG (reversed) Intergenic
No off target data available for this crispr