ID: 1136724758

View in Genome Browser
Species Human (GRCh38)
Location 16:32348799-32348821
Sequence GGCGACTGCTCCACATCCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136724753_1136724758 5 Left 1136724753 16:32348771-32348793 CCCTGGGGTCGGCTTGGGCGCCG No data
Right 1136724758 16:32348799-32348821 GGCGACTGCTCCACATCCACCGG No data
1136724744_1136724758 29 Left 1136724744 16:32348747-32348769 CCTTCAGCTCCTTGCGGGGGTCG No data
Right 1136724758 16:32348799-32348821 GGCGACTGCTCCACATCCACCGG No data
1136724754_1136724758 4 Left 1136724754 16:32348772-32348794 CCTGGGGTCGGCTTGGGCGCCGG No data
Right 1136724758 16:32348799-32348821 GGCGACTGCTCCACATCCACCGG No data
1136724748_1136724758 20 Left 1136724748 16:32348756-32348778 CCTTGCGGGGGTCGGCCCTGGGG No data
Right 1136724758 16:32348799-32348821 GGCGACTGCTCCACATCCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136724758 Original CRISPR GGCGACTGCTCCACATCCAC CGG Intergenic