ID: 1136724760

View in Genome Browser
Species Human (GRCh38)
Location 16:32348805-32348827
Sequence TGCTCCACATCCACCGGGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136724757_1136724760 -9 Left 1136724757 16:32348791-32348813 CCGGCAGCGGCGACTGCTCCACA No data
Right 1136724760 16:32348805-32348827 TGCTCCACATCCACCGGGTCCGG No data
1136724753_1136724760 11 Left 1136724753 16:32348771-32348793 CCCTGGGGTCGGCTTGGGCGCCG No data
Right 1136724760 16:32348805-32348827 TGCTCCACATCCACCGGGTCCGG No data
1136724754_1136724760 10 Left 1136724754 16:32348772-32348794 CCTGGGGTCGGCTTGGGCGCCGG No data
Right 1136724760 16:32348805-32348827 TGCTCCACATCCACCGGGTCCGG No data
1136724748_1136724760 26 Left 1136724748 16:32348756-32348778 CCTTGCGGGGGTCGGCCCTGGGG No data
Right 1136724760 16:32348805-32348827 TGCTCCACATCCACCGGGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136724760 Original CRISPR TGCTCCACATCCACCGGGTC CGG Intergenic
No off target data available for this crispr