ID: 1136724762

View in Genome Browser
Species Human (GRCh38)
Location 16:32348809-32348831
Sequence CGGCCCGGACCCGGTGGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136724762_1136724767 -3 Left 1136724762 16:32348809-32348831 CCACATCCACCGGGTCCGGGCCG No data
Right 1136724767 16:32348829-32348851 CCGCGTCCGCCTCGAGCTAACGG No data
1136724762_1136724775 30 Left 1136724762 16:32348809-32348831 CCACATCCACCGGGTCCGGGCCG No data
Right 1136724775 16:32348862-32348884 TAGGCGCGCGCGCCAGTTCCGGG No data
1136724762_1136724770 11 Left 1136724762 16:32348809-32348831 CCACATCCACCGGGTCCGGGCCG No data
Right 1136724770 16:32348843-32348865 AGCTAACGGTCCCGCCAGCTAGG No data
1136724762_1136724774 29 Left 1136724762 16:32348809-32348831 CCACATCCACCGGGTCCGGGCCG No data
Right 1136724774 16:32348861-32348883 CTAGGCGCGCGCGCCAGTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136724762 Original CRISPR CGGCCCGGACCCGGTGGATG TGG (reversed) Intergenic