ID: 1136724767

View in Genome Browser
Species Human (GRCh38)
Location 16:32348829-32348851
Sequence CCGCGTCCGCCTCGAGCTAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136724762_1136724767 -3 Left 1136724762 16:32348809-32348831 CCACATCCACCGGGTCCGGGCCG No data
Right 1136724767 16:32348829-32348851 CCGCGTCCGCCTCGAGCTAACGG No data
1136724757_1136724767 15 Left 1136724757 16:32348791-32348813 CCGGCAGCGGCGACTGCTCCACA No data
Right 1136724767 16:32348829-32348851 CCGCGTCCGCCTCGAGCTAACGG No data
1136724763_1136724767 -9 Left 1136724763 16:32348815-32348837 CCACCGGGTCCGGGCCGCGTCCG No data
Right 1136724767 16:32348829-32348851 CCGCGTCCGCCTCGAGCTAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136724767 Original CRISPR CCGCGTCCGCCTCGAGCTAA CGG Intergenic
No off target data available for this crispr