ID: 1136724770

View in Genome Browser
Species Human (GRCh38)
Location 16:32348843-32348865
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136724766_1136724770 -9 Left 1136724766 16:32348829-32348851 CCGCGTCCGCCTCGAGCTAACGG No data
Right 1136724770 16:32348843-32348865 AGCTAACGGTCCCGCCAGCTAGG No data
1136724765_1136724770 -4 Left 1136724765 16:32348824-32348846 CCGGGCCGCGTCCGCCTCGAGCT No data
Right 1136724770 16:32348843-32348865 AGCTAACGGTCCCGCCAGCTAGG No data
1136724763_1136724770 5 Left 1136724763 16:32348815-32348837 CCACCGGGTCCGGGCCGCGTCCG No data
Right 1136724770 16:32348843-32348865 AGCTAACGGTCCCGCCAGCTAGG No data
1136724764_1136724770 2 Left 1136724764 16:32348818-32348840 CCGGGTCCGGGCCGCGTCCGCCT No data
Right 1136724770 16:32348843-32348865 AGCTAACGGTCCCGCCAGCTAGG No data
1136724757_1136724770 29 Left 1136724757 16:32348791-32348813 CCGGCAGCGGCGACTGCTCCACA No data
Right 1136724770 16:32348843-32348865 AGCTAACGGTCCCGCCAGCTAGG No data
1136724762_1136724770 11 Left 1136724762 16:32348809-32348831 CCACATCCACCGGGTCCGGGCCG No data
Right 1136724770 16:32348843-32348865 AGCTAACGGTCCCGCCAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136724770 Original CRISPR AGCTAACGGTCCCGCCAGCT AGG Intergenic