ID: 1136724774

View in Genome Browser
Species Human (GRCh38)
Location 16:32348861-32348883
Sequence CTAGGCGCGCGCGCCAGTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136724766_1136724774 9 Left 1136724766 16:32348829-32348851 CCGCGTCCGCCTCGAGCTAACGG No data
Right 1136724774 16:32348861-32348883 CTAGGCGCGCGCGCCAGTTCCGG No data
1136724765_1136724774 14 Left 1136724765 16:32348824-32348846 CCGGGCCGCGTCCGCCTCGAGCT No data
Right 1136724774 16:32348861-32348883 CTAGGCGCGCGCGCCAGTTCCGG No data
1136724764_1136724774 20 Left 1136724764 16:32348818-32348840 CCGGGTCCGGGCCGCGTCCGCCT No data
Right 1136724774 16:32348861-32348883 CTAGGCGCGCGCGCCAGTTCCGG No data
1136724763_1136724774 23 Left 1136724763 16:32348815-32348837 CCACCGGGTCCGGGCCGCGTCCG No data
Right 1136724774 16:32348861-32348883 CTAGGCGCGCGCGCCAGTTCCGG No data
1136724762_1136724774 29 Left 1136724762 16:32348809-32348831 CCACATCCACCGGGTCCGGGCCG No data
Right 1136724774 16:32348861-32348883 CTAGGCGCGCGCGCCAGTTCCGG No data
1136724769_1136724774 0 Left 1136724769 16:32348838-32348860 CCTCGAGCTAACGGTCCCGCCAG No data
Right 1136724774 16:32348861-32348883 CTAGGCGCGCGCGCCAGTTCCGG No data
1136724768_1136724774 3 Left 1136724768 16:32348835-32348857 CCGCCTCGAGCTAACGGTCCCGC No data
Right 1136724774 16:32348861-32348883 CTAGGCGCGCGCGCCAGTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136724774 Original CRISPR CTAGGCGCGCGCGCCAGTTC CGG Intergenic