ID: 1136725369

View in Genome Browser
Species Human (GRCh38)
Location 16:32353145-32353167
Sequence AAACATGAACAAATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136725369_1136725381 28 Left 1136725369 16:32353145-32353167 CCCAGCTCCATTTGTTCATGTTT No data
Right 1136725381 16:32353196-32353218 GGCCAGTGGGAACAGCTCCATGG No data
1136725369_1136725372 5 Left 1136725369 16:32353145-32353167 CCCAGCTCCATTTGTTCATGTTT No data
Right 1136725372 16:32353173-32353195 TCCTACACCCACCTCTAGCTAGG No data
1136725369_1136725378 14 Left 1136725369 16:32353145-32353167 CCCAGCTCCATTTGTTCATGTTT No data
Right 1136725378 16:32353182-32353204 CACCTCTAGCTAGGGGCCAGTGG No data
1136725369_1136725374 6 Left 1136725369 16:32353145-32353167 CCCAGCTCCATTTGTTCATGTTT No data
Right 1136725374 16:32353174-32353196 CCTACACCCACCTCTAGCTAGGG No data
1136725369_1136725375 7 Left 1136725369 16:32353145-32353167 CCCAGCTCCATTTGTTCATGTTT No data
Right 1136725375 16:32353175-32353197 CTACACCCACCTCTAGCTAGGGG No data
1136725369_1136725379 15 Left 1136725369 16:32353145-32353167 CCCAGCTCCATTTGTTCATGTTT No data
Right 1136725379 16:32353183-32353205 ACCTCTAGCTAGGGGCCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136725369 Original CRISPR AAACATGAACAAATGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr