ID: 1136725449

View in Genome Browser
Species Human (GRCh38)
Location 16:32353614-32353636
Sequence TTCCCTACCCCATTAAGTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136725449_1136725452 14 Left 1136725449 16:32353614-32353636 CCATAACTTAATGGGGTAGGGAA No data
Right 1136725452 16:32353651-32353673 GATAAAATTAAAGTGACGTTAGG No data
1136725449_1136725453 19 Left 1136725449 16:32353614-32353636 CCATAACTTAATGGGGTAGGGAA No data
Right 1136725453 16:32353656-32353678 AATTAAAGTGACGTTAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136725449 Original CRISPR TTCCCTACCCCATTAAGTTA TGG (reversed) Intergenic
No off target data available for this crispr