ID: 1136730314

View in Genome Browser
Species Human (GRCh38)
Location 16:32405509-32405531
Sequence GTTTATTAGGATGGCCAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136730314_1136730319 22 Left 1136730314 16:32405509-32405531 CCTTTTTGGCCATCCTAATAAAC No data
Right 1136730319 16:32405554-32405576 CGACATAAACATACAGAGCTGGG No data
1136730314_1136730318 21 Left 1136730314 16:32405509-32405531 CCTTTTTGGCCATCCTAATAAAC No data
Right 1136730318 16:32405553-32405575 ACGACATAAACATACAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136730314 Original CRISPR GTTTATTAGGATGGCCAAAA AGG (reversed) Intergenic
No off target data available for this crispr