ID: 1136730316

View in Genome Browser
Species Human (GRCh38)
Location 16:32405518-32405540
Sequence CAACCATTTGTTTATTAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136730316_1136730319 13 Left 1136730316 16:32405518-32405540 CCATCCTAATAAACAAATGGTTG No data
Right 1136730319 16:32405554-32405576 CGACATAAACATACAGAGCTGGG No data
1136730316_1136730318 12 Left 1136730316 16:32405518-32405540 CCATCCTAATAAACAAATGGTTG No data
Right 1136730318 16:32405553-32405575 ACGACATAAACATACAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136730316 Original CRISPR CAACCATTTGTTTATTAGGA TGG (reversed) Intergenic
No off target data available for this crispr